Question 8

True or False?: Voice classifications are strict and must be followed at all times. There will
never be a point where someone will change different voice classifications.
O True
O False

Answers

Answer 1

Answer: True

Explanation:

Answer 2

Answer:

true

Explanation:

if someone in the choir or band are not followed then the whole group will be confused on which part they and the others are


Related Questions

when was the Mona Lisa first Made ​

Answers

Explanation:

it was painted between 1503 and 1519 it now hangs in the Louvre Museum

Can Water colour paint be used to paint terracotta pots?

Answers

Answer:

No, not really...

Explanation:

These types of pots can be used to plant plants, and we water plants. They are made to be water resistant. They are already orange and it might leave a little tint when it dries but not successfully.

4.
whatis the amount of energy used
or exerted during the process of dancing
A. Time


B. Force
C. Rhythm​

Answers

Answer:

C

Explanation:

dancing needs rhythm

The answer to your question is C, rhythm.

What is the drawing technique of using dots instead of lines called?
ОА.
cross-hatching
OB.
dotting
O C. stippling

Answers

Answer:

C

Explanation:

Stippling is just doing a bunch of dots

The drawing technique of using dots instead of lines called stippling. Thus option (C) is correct.

What is a Line?

A line is an infinitely long object with no width, depth, or curvature. Thus, lines are one-dimensional objects, though they may exist in two, three, or higher dimension spaces.

A line is a straight one-dimensional figure that does not have a thickness, and it extends endlessly in both directions.

A line does not have any endpoint. The two arrows at each end signify that the line extends endlessly and is unending in both directions. The length of a line cannot be measured.

In geometry, there are different types of lines such as horizontal and vertical lines, parallel and perpendicular lines.

The drawing technique of using dots instead of lines called stippling. Therefore, option (C) is correct.

Learn more about line here:

https://brainly.com/question/29176531

#SPJ5

how did early humans specifically use musical sounds and how was it “passed on” to the future societies?

Answers

Music must first be defined and distinguished from speech, and from animal and bird cries

Help please ASAP!!!!!! It’s for music i ain’t good

Answers

Hey there! I'm happy to help!

Unfortunately I cannot physically write the notes down for you, but I can give you guidance on what notes are which and where the different ones go.

In the treble clef, the bottom line is E. The line above that is G. Next line is B. Then D. Then F.

So, I've been taught this little mnemonic device to remember it.

Every

Good

Boy

Does

Fine

The space right above that bottom E is F. The space above that is A. Then C. Then E.

So, you just remember that the spaces in the treble clef spell out FACE.

For bass clef, the lines start at G.

Good

Boys

Do

Fine

Always

And the spaces spell ACEG. This isn't a word but that's what you need to remember is that it is ACEG.

Also, the question notifies you to watch the stems.

If the note is below the middle line, the stem goes on the left side and points down.

If the note is above the middle line, the stem goes on the right side and points up.

If it is on the middle line, it is honestly either or. It depends on the situation and it can go either way.

I hope that this is helpful to you! Have a wonderful day and keep on learning! :D

The topic is Nutrition
What is your first reaction to this topic?
What interests you about this topic?
What do you already know about this topic?
How does this topic relate to you or to people you know?
When has this topic come up recently in conversation, in the news, or in something you’ve read?
What is appropriate for a class discussion?
Brainstorm to generate ideas. Use the questions on the left to help you.
PLZZZZZZZZZ HELP!!!!!!

Answers

Answer:

Here are my answers for help.

Explanation:

1. Reminds me of healthy food and dieting.

2. How each food affects each body part.

3. I know the food table, what foods are good for each part of the body, etc.

4. My dad has high blood pressure so he has to watch the food he eats.

5. In school during health class, also in a science program.

6. Talking about what you should eat and how.

why no one is not answering my questions it is easy and i gave you high points toooo​

Answers

Answer:

OK let's ask now I am here to help everyone

What woman artist has had the greatest impact on the public’s opinion of women in the arts at the turn of the 20th century through her work with the Armory Show?
Georgia O’Keeffe
Betye Saar
Cindy Sherman

Answers

Answer:

Georgia O’Keeffe

Explanation:

Georgia O’Keeffe

There are a lot of great women artist. What woman artist has had the greatest impact on the public’s opinion of women in the arts at the turn of the 20th century is Georgia O’Keeffe.

In the 20th century, O'Keeffe was known as one of America's most important and successful artists, She was a modernize artist and she ia reputable for her paintings of New York skyscrapers.

She was known to be the first female painter that had a lot of respect in New York's art world in the 1920s.

Conclusively, She uses specific and creative new way of painting nature, making easy its shapes and forms.

Learn more about Women artist from

https://brainly.com/question/23482750

How did the camera obscura lead to the science of photography?

Answers

Answer:

It paved the way for photography to be greatly improved, and hence a much better and wider use for photography, at the same time making it much more accessible to the public.

Explanation:

HELP!!! With lessons 5 and 6 I don’t understand thanks it’s due today

Answers

Answer:

I suggest reading everything on lesson 5 over again, since the answers are in there. Otherwise, you can always look up a music theory video.

I hope this helps!

Explanation:

Brainliest, please!

Marlo wrote a narrative about a mechanic. Read the beginning of the story below: (1) Rick was crouched beside a motorcycle with a wrench in his hand. (2) The floor of the garage was covered in grease stains, and he was only adding to the mess. (3) A slick of coolant poured from the broken Harley. (4) Even though Rick was great with cars, he was out of his depth working on his dad’s motorcycle. Which sentence introduces the setting of the narrative? A. sentence 1 B. sentence 2 C. sentence 3 D. sentence 4

Answers

Answer:

The answer is B

Explanation:

The setting of a narrative explains the time and/or place in which the story takes place. In sentence 2, (“The floor of the garage was covered in grease stains, and he was only adding to the mess.”) it describes the garage which is the place that this takes place in. I hope this helps you :)

Answer:

B. Sentence 2.

Explanation:

Read the description:

Student Voice is a magazine that provides information about different clubs in schools, award winning novels, and cool experiments that can be completed at home.

Select the correct way to format the title.

Student Voice
"Student Voice"
Student Voice
(Student Voice)

Answers

Answer:

Student Voice

Explanation:

Student Voice is a magazine that provides information about different clubs in schools, award winning novels, and cool experiments that can be completed at home.

Who could access portable portraits that changed who had access to the technology?

Answers

Portable portraits are one which are mobile images. The technology have emerged and now stand still portrait can move to different places creating mobility.

There are various medium of advertisement, but a customer is more attracted with physical display of a good.

This leaves an impact on his mind and a good advertisement leads him to purchase the product and make a buy decision immediately because a customer is inspired by product features.

These emerging technology have eased the business men problems. The images and portraits they wish to sell in different location can be move through portable portraits technique.

learn more at https://brainly.com/question/24374347

Read the beginning of a narrative about pioneers in the American West: Maisie winced as her brother sang “Oh! Susanna” yet again. This trip was going to be endless if he didn’t find a new song—and soon. “Samuel! Please! Enough with the ‘Oh! Susanna.’ I can hardly hear myself think.” “O, Susanna!” Samuel sang even louder. What element of effective narratives is this introduction missing? A. plot B. setting C. conflict D. characters

Answers

Answer:

A. plot

Explanation:

B, C & D can all be seen in the narrative. We have the setting, American west, we have the conflict of Maisie brothers singing and how horrible it is and we know the characters are Maisie and her brother Samuels.

The plot element of effective narratives is this introduction missing. Thus, option (a) is correct.

What is narrative?

A narrative is a novel written from the main character's point of view. A narrative is a story or a chronicle of a series of events. An clause written by a individual about his/her experience going across the United States on a cycle would most likely be a narrative.

According to the narrative, are the missing plot elements in the story. The plot was the event sequence and the right order to maintain. Plot requires a far greater level of narrative order than is typical in a story or fable.

As a result, the plot element of effective narratives is this introduction missing. Therefore, option (a) is correct.

Learn more about on narrative, here:

https://brainly.com/question/2134080

#SPJ2

Which drawing material do you need to fix with varnish to avold smearing once your drawing is complete?
pencil
O charcoal
pen and Ink
silverpoint​

Answers

Answer:

silver point

Explanation:

i have experience with fixing art without smearing it

(because my sister always asks me to do that, because she says art is ''hard'')

What can I do to make this better?

Answers

you can draw a head and a little mouth

Explanation:

you can draw eyebrows, a mouth, and a face...

What kinds of valuable activities does one engage in when creating or examining works of art?
Name two of the decisions
you
face.

Answers

Answer:

It stimulates the mind, defines one's self, and expresses the artist's values.

The decisions we face in when creating or examining works of art are :

It stimulates the mind and defines one's self.Expresses the artist's values.What is Art?Art is studied because “it is among the highest expressions of culture, embodying its ideals and aspirations, challenging its assumptions and beliefs, and creating new visions and possibilities for it to pursue.How We Assign Value to Art?The word art is often used to apply judgments of value, as in expressions like “that meal was a work of art” (implying that the cook is an artist) or “the art of deception” (the advanced, praiseworthy skill of deceiving). It is this use of the word as a measure of high value that gives the term its flavor of subjectivity.

Learn more about Art on:

brainly.com/question/25729154

#SPJ2

How many squares do u see

Answers

I see 9 squares sorry if it’s wrong

I see fifteen (15) squares.

Question- Show painting on 'gandgi mukt mera gaon' with oil pastels color.​

Answers

As per your request here is a drawing of clean village drawn with oil pastels !!

Give an
example of an analogous color scheme.

Answers

Analogous colors means the color grouping has similarities. ... Here are a few examples of analogous color schemes: Yellow, yellow-green, green. Violet, red-violet, and red.

Who painted the image below? A painting titled Hunters in the Snow (Winter). Hunters walk through a snow-covered town while people skate on a lake covered by ice.

Answers

Answer:

Pieter Bruegel the Elder

Explanation:

Answer:

Pieter Bruegel the Elder

Explanation:

Which of these are hospitality and recreational projects? Select all that apply.

☐banks and churches

☐clubs and resorts

☐hotels and restaurants

☐schools and libraries

Answers

Answer:

clubes y centros turísticos

Explanation:

All ideas, forms, techniques, and strategies that humans employ to express themselves creatively and to communicate their creativity and inspiration to others. Give yourself three minutes to think of all the different sorts of art you can type in the space below.

Answers

Answer:

There are different art, humans can employ to express themselves creatively and to communicate their creativity and inspiration to others. Some of the art are as following:

Sketching and Craft: Sketching and craft is the best way one can use to communicate their thoughts without using words.Writing poems: Poems are very creative art that expresses your thoughts in an interesting manner and communicate a lot with less words.Theaters: Theaters are the best places where artists spread or communicate their views and ideas through their acting following a script.Social media: Social media nowadays become the best way to communicate with the audience and to express their creativity to the whole world.

Martin drew a plan for his new house on translucent paper. He would like to make a blueprint of his drawing. Which alternative method is best for making blueprints or reproducing drawings?
A.
cyanotype
B.
Polaroid
C.
negative sandwiching
D.
solarization

Answers

Answer:

A. Cyanotype

Explanation: I got it correct on edmentum.

The correct option is A. Cyanotype is best for making blueprints or reproducing drawings. Martin drew a plan for his new house on translucent paper. He would like to make a blueprint of his drawing by using cyanotype. You may easily print photos at home using the cyanotype method with a few simple supplies.

What is the role of vinegar in cyanotype?

A cyanotype developer employing vinegar produced the desired results. In these studies, the vinegar accomplishes two beneficial tasks: it dramatically increases the amount of midtone detail that comes through on my negatives and produces a pleasing print in around half the exposure time that water development needs.

It creates a cyan-blue print that can be utilized for reprography in the form of blueprints and for art as monochromatic images that can be applied to a variety of surfaces. Ferric ammonium citrate or ferric ammonium oxalate, potassium ferricyanide, and just water are typically used in the process for all purposes.

Learn more about Cyanotype here:

https://brainly.com/question/23313328

#SPJ2

If Social Media Apps had a Rap Battle Mr. Grande lyrics 2020 Does anyone know the lyrics?

Answers

Answer: [Verse 1: Burger King]

What is this?

Battle of the burgers?

Y'all are insane

To think that you are better

When the word "king"

In my name

All y'all food is oily

We been knew

That's spoiled tea

Sorry you cannot compete

Cause Burger King

Invented royalty

Wendy you're a restaurant?

That's gotta be pretend

Cause last that I remember

You were Peter Pan's best friend

I think that it just hit her

That I am the winner

I'm famous for my burgers

You're just famous for Twitter

Now let's talk about

The over-rated Taco Bell

Your food is just the worst

And you're the devil

Of the Taco Hell

Oops too bad my taco fell

I'm Apple

And you're Taco Dell

Our cardboard crowns

Aren't as cardboard

As your taco shells

I only speak the truth

And your food is just strange

Have you ever thought of

Using real meat for a change?

Alright who's next?

M... M... McDonald's!

We meet again

Since we're talking bout meat

Yours is just pretend

Your my biggest competition

But you're also the worst

You think you invented burgers?

Little did you know I did it first

Talk about health

What have you done?

Your food is like a

Mc'heart attack in a bun

That's all I have for now

I'll see you on another day

Keep on serving up trash

I'll keep on having it my way

Explanation: That could a rap battle for Mr. Grande lyrics.

2. By openly discussing your point of view with others, you might___________
A.See some things you missed before
B.Learn to interpret works from a completely different angle
C.Neither A and B
D.Both A or B

Answers

Hi! The answer is D. = Both A and B. The reason this is is because when you discuss your point of view on things with others you will see some points you may not have seen before along with you may see something in a different view point based of what the person you are discussing with believes. I hope this helped, Goodluck :)

Answer Key :
D. = Both A and B.
The answer is D, both A and B.

What culture flourished on the Greek mainland in the Late Bronze Age, and what was this period viewed as by the Greeks?

Answers

Answer:

Mycenaean culture

Explanation:

The culture that  flourished on the Greek mainland in the Late Bronze Age was Mycenaean culture. The period viewed as by the Greeks 1600 to 1100 B.C.E.

What is  Mycenaean culture?

The culture that was followed in the period of 1600 to 1100 B.C.E.by the Ancient Greek was known as Mycenaean culture. It  was the final stage of the Bronze Age.

The Mycenaean culture was one of the highest developed Greek culture which included that activities like urban planning, artistic creations, and writing system which differed it from the other cultures. It was a distinct culture of the Greek origin.

Therefore, it can be concluded that In the Late Bronze Age, roughly between 1600 and 1100 B.C.E, Mycenaean civilization flourished on the Greek mainland.

Learn more about Mycenaean culture here:

https://brainly.com/question/10618658

#SPJ2

What are the gender symbols on the bathroom doors at school and other illustrated symbols that stand for some concept called? A. icons B. isotypes C. pictographs

Answers

Answer: pictograph

I hope this is right!

Answer:

for plato family

c. pictographs

Explanation:

I just took the test .

The music teacher told the tenors to sing a D note, the altos an F note, and the sopranos an A note, all at the same time. What is the music teacher MOST likely trying to create?

A.
harmony

B.
melody

C.
dissonance

D.
crescendo

Answers

Answer:

harmony !!

Explanation:

when a choir is all singing different notes but blending together it creates a harmony

melody is the main part consistent throughout the piece

dissonance is the lack of harmony

crescendo is the dynamic of increasing volume for emphasis

Other Questions
Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting A single-slit diffraction pattern is formed on a distant screen. Assuming the angles involved are small, by what factor will the width of the central bright spot on the screen change if the slit width is doubled?a. It will become four times as large.b. It will double.c. It will be cut in half.d. It will become eight times as large.e. It will be cut to one-quarter its original size. Show Work! A warehouse worker shipped 289 boxes of notebooks. Each box contained 36 notebooks. What was the total number of notebooks shipped?(A) 2, 601(B) 9, 404(C) 10, 404(D) 10, 413 Adnde ______ ustedes? Question 18 options: a) voy b) va c) van d) vamos 7. Characteristics of a newsworthy incident include: timeliness, proximity, prominence, uniqueness, human interest, and: A. Visual interest B. Conflict C. Media agenda D. An easily understood situation Write the equation for each question: 9. the sum of 5 and four times a number is 3210. four less than the square of a number is 1211. The product of 3 and four more than a number is 20Marking Brainliest -3(-5x-2u+1) use the distributive property to remove the parentheses A bio catalyst that increases the rate of the reaction without being changeda) Aluminum oxide. b) Silicon dioxide. c) Enzyme. d) Hydrogen peroxide43. What is thethan the reaction substrate.42. A If Ab = 54, find MC. How does coronavirus causes severe pneumonia?