Consider a firm Theta that spends $60 to produce goods in year 1. In year 2 it sells these goods for $100, but its customers pay their bills with a delay, therefore the payment is not received until year 3. What's the amount of net income recorded on the income statement for each year?

Answers

Answer 1

Answer:

Theta

Amount of net income for each year:

Year 1 = $0

Year 2 = $40 ($100 - $60)

Year 3 = $0

Explanation:

The net income to be recorded in Theta's income statement depends on the period in which revenue is recorded.  In year 1, Theta would accumulated Ending Inventory of $60 being the cost of its finished goods inventory.  Since it has not made any sales, there is no net income to record, which is always the difference between revenue and cost of goods or services sold.  In year 2, the actual sales revenue was made and recorded in the accounts.  This is the period for Theta to calculate its profit against the cost of goods sold.  In year 3 when cash payment was received from customers, the accounts of Theta would record the receipt only in settlement of the customer debt.  This transaction does not affect the revenue or the cost of goods sold, two important elements for determining the profit made.


Related Questions

The ___________ incorporates a line receiver in order to convert the optical signal into the electrical regime.
a) Attenuator
b) Transmitter
c) Repeater
d) Designator

Answers

Answer: repeater

Explanation:

The attenuation is used to limits the maximum distance that occurs between an optical fiber transmitter and the receiver.

It should be noted that the repeater helps to incorporates a line receiver to convert the optical signal into the electrical regime.

All of the following actions by a custodian in an account opened under the Uniform Gifts to Minors Act are permitted except:_______.
A. donating funds to the account to make additional investments
B. withdrawing funds from the account for the custodian's use
C. managing the investments in the account with the objective of generating enough income for college tuition
D. selling securities in the account to generate proceeds for other investments

Answers

Answer: B. withdrawing funds from the account for the custodian's use

Explanation:

Under the Uniform Gifts to Minors Act, the Custodian's duty is to manage the account for the minor and allocate the assets within in such a way that it will bring about the best returns for the minor.

Custodians should not abuse this power for their own benefit or gain which is why the custodian withdrawing funds from the account for their own use is a violation of the act.

You purchased a stock at a price of $46.55. The stock paid a dividend of $1.79 per share and the stock price at the end of the year is $52.45. What was the dividend yield

Answers

Answer:

3.84%

Explanation:

Calculation for dividend yield

Using this formula

Dividend Yield(%) = D / P0

Where,

D=$1.79

P0=$46.55

Let plug in the formula

Dividend Yield(%) =$1.79/$46.55

Dividend Yield(%) =0.0384*100

Dividend Yield(%) =3.84%

Therefore the dividend yield will be 3.84%

g An increase in taxes when the economy is above full employment ​ ______ aggregate demand and real​ GDP, and the price level​ ______.

Answers

Answer:

C.  ​decreases; falls

Explanation:

As we know that

The rise in taxes results in low disposable income for individuals that lowered the spending of the consumer also the consumer spending is an element of the aggregate demand so ultimately it declines that result the curve to shift leftward or downward

Due to this, the real GDP also falls, and the price level too

Hence, the correct option is c.

Your auto dealer gives you the choice to pay $15,500 cash now, or make three payments: $8,200 now, $4,200 in one year and $3,200 in two years. If your cost of money (discount rate) is 7.25%, what is the PV of the installment plan?

Answers

Answer:

The answer is $14,898.07

Explanation:

Assume that the cost of money (discount rate) of 7.25% is on annual basis.

Present value (PV) of the installment plan is:

PV = Down payment + PV(first installment) + PV(second installment)

= $8,200 + $4,200 / (1 + 7.25%) + $3,200 / (1 + 7.25%)^2 = $14,898.07

Obviously, the three payments option is more lucrative than the 100% down payment one.

In its most recent annual report, Appalachian Beverages reported current assets of $70,300 and a current ratio of 1.90. Assume that the following transactions were completed:_________.
(1) purchased merchandise for $6,700 on account and (2) purchased a delivery truck for $10,000, paying $2,000 cash and signing a two-year promissory note for the balance.
Compute the updated current ratio (round answers to 2 decimal places)Transaction (1) ________________Transaction (2) ________________I am not sure how to do this problem, I understand how to general compute the current ration:________.Current raion= currenct assets/current liabilitiesbut how do you do compute an update?If someone could show me how to do this correctly, I will award them lifesaver.

Answers

Answer:

Appalachian Beverages

With reported current assets of $70,300 and a current ratio of 1.90, one can work out the current liabilities from these two.  The current liabilities are equal to $70,300/1.90 - $37,000.  To work back, one can state that current ratio equals $70,300/$37,000 = 1.90.

Having ascertained the value of the former current liabilities, one can use the information to update the two parameters for calculating the current ratio as follows:

Current liabilities increased by $6,700 from purchase of merchandise on account and of a delivery truck by $8,000.  So, the updated current liabilities equal to $37,000 + 6,700 + 8,000 = $51,700.  Similarly, the current assets decreased by $2,000 for the part-payment for the delivery truck.  Thus, current assets are now equal to $68,300 ($70,300 - 2,000).

Having updated the two parameters, one can then compute the updated current ratio as follows:

Current ratio = current assets/current liabilities = $68,300/$51,700 = 1.32.

Explanation:

Appalachian Beverages' current ratio shows the relationship between current assets and current liabilities and the ability of the entity to settle current liabilities with current assets.

Effects of fixed and variable cost behavior on the risk and rewards of business opportunities LO 11-2

Kenton and Denton Universities offer executive training courses to corporate clients. Kenton pays its instructors $5,000 per course taught. Denton pays its instructors $250 per student enrolled in the class. Both universities charge executives a $450 tuition fee per course attended.


Required

Prepare income statements for Kenton and Denton, assuming that 20 students attend a course.

Kenton University embarks on a strategy to entice students from Denton University by lowering its tuition to $240 per course. Prepare an income statement for Kenton assuming that the university is successful and enrolls 40 students in its course.

Denton University embarks on a strategy to entice students from Kenton University by lowering its tuition to $240 per course. Prepare an income statement for Denton, assuming that the university is successful and enrolls 40 students in its course.

Prepare income statements for Kenton and Denton Universities, assuming that 10 students attend a course, and assuming that both universities charge executives a $450 tuition fee per course attended.

Answers

Answer and Explanation:

The Preparation of income statement of each point is shown below:-

 A.                           Kenton and Denton Universities

                                             Income Statement

Particulars                                   Kenton        Denton

Revenue (20 × $450)                  $9,000      $9,000

Less: Instruction fees

Per course fees                         $5,000

Per student fee (20 × $250)                           $5,000

Net income                                 $4,000         $4,000

B.                                          Kenton Universities

                                             Income Statement

Particulars                                   Kenton      

Revenue (40 × $240)                  $9,600

Less: Instruction fees

Per course fees                           $5,000

Net income                                  $4,600

C.                                           Denton Universities

                                             Income Statement

Particulars                                     Denton  

Revenue (40 × $240)                  $9,600

Less: Instruction fees

Per student fee (40 × $250)       $10,000

Net income                                  -$400

D.                            Kenton and Denton Universities

                                             Income Statement

Particulars                                   Kenton        Denton

Revenue (10 × $450)                  $4,500      $4,500

Less: Instruction fees

Per course fees                         $5,000

Per student fee (10 × $250)                           $2,500

Net income                                 -$500         $2,000

We simply deduct all the expenses from the revenue to arrive at net income and a net loss

write at list 4 point about book and account​

Answers

Explanation:

Bookkeeping is the recording of financial transactions, and is part of the process of accounting in business. Transactions include purchases, sales, receipts, and payments by an individual person or an organization/corporation. There are several standard methods of bookkeeping, including the single-entry and double-entry bookkeeping systems. While these may be viewed as "real" bookkeeping, any process for recording financial transactions is a bookkeeping process.

Contemporary businesses have embraced leaner corporate hierarchies, simultaneously relying on teams, eliminating division walls, and blurring the lines of authority. As teams and managers are abandoning the traditional command structure, excellent persuasive skills are becoming ever more important at work.To be persuasive, you must be respectful and _________a. Authentic b. Commanding c. Blunt d. Authoritative How has persuasion changed in the digital age? a. All businesses are in the persuasion business b. Persuasion is more complex and impersonal c. Persuasive techniques are more subtle and misleading d. Persuasive messages are slow to engage audiences e. Persuasive messages are targeted to very specific audiences

Answers

Answers:

Option a: authentic.

Option A-E of the second question are all correct.they are the characteristics of Persuasion in this digital age.

Option a. All businesses are in the persuasion business

Option b. Persuasion is more complex and impersonal

Option c. Persuasive techniques are more subtle and misleading

Option d: Persuasive messages are slow to engage audiences

Option e. Persuasive messages are targeted to very specific audiences

Explanation:

In business, persuasion is the ability to influence others especially in decision making. Persuasive skills are essential at work as teams and managers leaves traditional command structure and focus instead on influencing others. An individual must be genuinely respectful and authentic that is they are people who are very intuitive and will know any effort to manipulate them. Using authority as a way to persuade does not generate respect. Instead of a blunt,commanding, pushy hard-sell approach, persuaders play on emotions by using flattery, empathy.

Persuasive techniques in the digital age are more subtle and misleading due to the fact that blunt, pushy hard-sell approach, persuaders play on emotions by using flattery, empathy, nonverbal cues, e. t. c which can be more subtle and misleading

The total factory overhead for Bardot Marine Company is budgeted for the year at $367,500. Bardot Marine manufactures two types of boats: speed boats and bass boats. The speedboat and bass boat each require three direct labor hours for manufacture. Each product is budgeted for 5,000 units of production for the year.
When required, round all per unit answers to the nearest cent.
A. Determine the total number of budgeted direct labor hours for the year in each department.
Fabrication direct labor hours
Assembly direct labor hours
B. Determine the departmental factory overhead rates for both departments.
Fabrication $ per dlh
Assembly $ per dlh
C. Determine the factory overhead allocated per unit for each product using the department factory overhead allocation rates.
Speedboat: $ per unit
Bass boat: $ per unit

Answers

Question Completion:

The speed boat requires 2 hours in fabrication and 1 hour in assembly.  The bass boat requires 1 hour in fabrication and 2 hours in assembly.

Answer:

Bardot Marine Company

A. Determination of the total number of budgeted direct labor hours in each department:

                             Speed boats    Bass boats   Total hours

Direct labor hours:

Fabrication                10,000           5,000           15,000

Assembly                   5,000          10,000           15,000

Total                         15,000          15,000           30,000

B. Determination of the departmental factory overhead rates for both departments:

Overhead rate = $367,500/30,000 = $12.25

Fabrication $ per dlh  = $12.25

Assembly $ per dlh = $12.25

C. Determination of the factory overhead allocated per unit for each product using the department factory overhead allocation rates:

Speedboat: $ per unit  = $36.75 ($12.25 x 3)

Bass boat: $ per unit =   $36.75 ($12.25 x 3)

Explanation:

a) Data and Calculations:

Total factory overhead = $367,500

                                   Speed Boats        Bass Boats

Budgeted units                5,000                5,000

Hours per unit                   3                         3

Total direct labor hour   15,000              15,000

Fabrication                        2 hrs                   1 hr    

Assembly                           1 hr                    2 hrs

Total direct labour hours:

Fabrication                   10,000                 5,000

Assembly                      5,000                 10,000

Mortgage insurance rates vary with the perceived riskiness of the loan.Which of the following scenarios would result in a higher mortgage insurance premium?
A) Lower loan-to-value ratio
B) Shorter loan term
C) Stronger credit record of the borrower
D) A "cash-out" refinancing loan

Answers

Answer: D) A "cash-out" refinancing loan

Explanation:

A "cash-out" refinancing loan refers to when a person replaces the mortgage that they have on a house with a newer, larger mortgage than the balance of the previous mortgage on the house.

The difference between this new mortgage and the old one can then be withdrawn in cash.

This would attract a higher mortgage insurance premium because the value of debt has now increased because as earlier mentioned, the new mortgage will be larger than the previous one so to cater for this, the insurance premiums will rise.

Which of the following is true regarding the value of an option? A) Unlike the Black-Scholes formula, the Put-Call Parity suggests that the volatility of underlying asset is not a factor that affects the value of an option. B) The option premium is greater or equal to its intrinsic value because of the time premium. C) The call and put premiums are unrelated since they depend on different set of variables. D) The writer of the call option pays the same premium as the buyer of the put option. E) When the call option is out-of-the-money and the put option is in-the-money, the call must be more valuable than the put.

Answers

Answer: B) The option premium is greater or equal to its intrinsic value because of the time premium.

Explanation:

The option premium can be calculated by adding the time premium and the intrinsic value. The time premium is the part of the option premium that accounts for the time remaining till the premium matures while the intrinsic value is the difference between the value of underlying asset and the strike price.

As the time premium can be zero but never negative, the option premium can either be greater than its intrinsic value or equal to it. It cannot be lower than it because of the time premium.

Need help with number 5

Answers

Answer:

sorry it took me so long i totally forgot to answer

Explanation:

From what Sarah is doing we can conclude that she is performing a job analysis.

Given that she is observing and trying to learn about requirements of this job.

When performing a job analysis, the analyst is trying to get relevant information about the details of a job as well as the requirements of the job.

Job analysis are carried out most of the time to determine job placements.

In conclusion We can see this from what Sarah is doing, she is observing and asking questions on what the job entails in order to write a description for the job.

All of the following statements regarding convertible bonds are true except:_________.
A. Holders of convertible bonds can generally decide whether to convert to stock.
B. Holders of convertible bonds have the potential to profit from increases in stock price.
C. Holders of convertible bonds can choose when to convert to stock.
D. Holders of convertible bonds have the option to not convert and continue receiving bond interest payments and par value at maturity.
E. Holders of convertible bonds can choose how many shares of stock to receive at conversion.

Answers

Answer: Holders of convertible bonds can choose how many shares of stock to receive at conversion

Explanation:

A convertible bond is a debt security that yields the payment of interest, but can also be converted into equity shares or common stock that are predetermined.

The option that holders of convertible bonds can choose how many shares of stock to receive at conversion is wrong. This is because the number I shares that will be eventually converted will already have been fixed.

Brodrick Company expects to produce 21,200 units for the year ending December 31. A flexible budget for 21,200 units of production reflects sales of $508,800; variable costs of $63,600; and fixed costs of $142,000. Assume that actual sales for the year are $587,200 (26,300 units), actual variable costs for the year are $113,900, and actual fixed costs for the year are $137,000. Prepare a flexible budget performance report for the year.

Answers

Answer:

                Flexible budget performance report  for the year

                           Flexible budget  Actual     Variance   Fav/Unf

Sales                        631,200         587,200    44,000   UNF

Variable cost           (78,900)         (113,900)    35,000    F

Contribution            416,000         368,000   48,000   UNF

margin

Fixed cost               (142,000)        (137,000)    5000       UNF

Net operating          274,000        231,000    43,000    UNF

income

Working:

a. At flexible budget, selling price per unit = $508,800 / 21,200 = $24 per unit . Total sales =26,300 *24 = $631,200  

b. Variable cost per unit = $63,600 / 21,200 = $3 per unit . Total cost = 3 * 26,300 = 78,900

) A company finds that consumer demand quantity changes with respect to price at a rate given by D'(p) = - 2000 p 2 . Find the demand function if the company knows that 834 units of the product are demanded when the price is $5 per unit.

Answers

Answer:

D(p) = 2,000 ÷ Price + 434

Explanation:

The computation of the demand function is shown below:-

Number of units of the product = 3000 ÷ Price + C

834 = 2,000 ÷ $5 + C

834 = 400 + C

C = 834 - 400

C = 434

So, D(p) = 2,000 ÷ Price + 434

Therefore for computing the demand function we simply applied the above formula also we considered all the given information mentioned in the question

Homestead Crafts, a distributor of handmade gifts, operates out of owner Emma Finn’s house. At the end of the current period, Emma looks over her inventory and finds that she has 800 units (products) in her basement, 25 of which were damaged by water and cannot be sold. 180 units in her van, ready to deliver per a customer order, terms FOB destination. 200 units out on consignment to a friend who owns a retail store. How many units should Emma include in her company’s period-end inventory?

Answers

Answer: 1155

Explanation:

The solution guess thus to calculate the units in Ending Inventory:

Units of product on hand: 800 units

Add: Units in transit 180

Add: Units on consignment 200

Less: Damaged units 25

The number of units that Emma should include in her company’s period-end inventory will be:

= (800+180+200) - 25

= 1180 - 25

= 1155

Paper Express Company has a balance sheet which lists $85 million in assets, $40 million in liabilities, and $45 million in common shareholders' equity. It has 1,400,000 common shares outstanding. The replacement cost of the assets is $115 million. The market share price is $90.What is Paper Express's market value per share?

Answers

Answer:

$90

Explanation:

Based on the information given we were told that after the assets was replaced at the amount of $115 million, the Company market share price was the amount of $90 which simply means that Paper Express's market value per share will be the market share price of the amount of $90.

Therefore Paper Express's market value per share will be $90.

Issuing Stock
Professional Products Inc., a wholesaler of office products, was organized on February 5 of the current year, with an authorization of 50,000 shares of preferred 2% stock, $40 par and 1,000,000 shares of $8 par common stock. The following selected transactions were completed during the first year of operations:
Journalize the transactions.
Feb. 5. Issued 600,000 shares of common stock at par for cash.
Feb. 5
Feb. 5. Issued 1,500 shares of common stock at par to an attorney in payment of legal fees for organizing the corporation.
Feb. 5
Apr. 9. Issued 45,000 shares of common stock in exchange for land, buildings, and equipment with fair market prices of $100,000, $310,000, and $85,000 respectively.
For a compound transaction, if an amount box does not require an entry, leave it blank.
Apr. 9
June 14. Issued 30,000 shares of preferred stock at $53 for cash.
For a compound transaction, if an amount box does not require an entry, leave it blank.
June 14

Answers

Answer:

Feb. 5. Issued 600,000 shares of common stock at par for cash.

Dr Cash 4,800,000

    Cr Common stock 4,800,000

Feb. 5. Issued 1,500 shares of common stock at par to an attorney in payment of legal fees for organizing the corporation.

Dr Organization costs 12,000

    Cr Common stock 12,000

Apr. 9. Issued 45,000 shares of common stock in exchange for land, buildings, and equipment with fair market prices of $100,000, $310,000, and $85,000 respectively.

Dr Land 100,000

Dr Buildings 310,000

Dr Equipment 85,000

    Cr Common stock 360,000

    Cr Additional paid in capital: common stock 135,000

June 14. Issued 30,000 shares of preferred stock at $53 for cash.

Dr Cash 1,590,000

    Cr Common stock 240,000

    Cr Additional paid in capital: common stock 1,350,000

what is reductionasim​

Answers

Answer:

Thus, the ideas that physical bodies are collections of atoms or that a given mental state (e.g., one person's belief that snow is white) is identical to a particular physical state (the firing of certain neurons in that person's brain) are examples of reductionism.

Explanation:

If annual demand is 50,000 units, the ordering cost is $25 per order, and the holding cost is $5 per unit per year, which of the following is the optimal order quantity in order to minimize the total annual inventory cost?
A. 707
B. 909
C. 634
D. 500
E. 141

Answers

Answer:

22

3 25

6 15

a. Determine which variable is the dependent variable.

b. Compute the least squares estimated line.

c. Compute the coefficient of determination. How would you interpret this value22

3 25

6 15

a. Determine which variable is the dependent variable.

b. Compute the least squares estimated line.

c. Compute the coefficient of determination. How would you interpret this value

Budgeted production 1,092 units Actual production 905 units Materials: Standard price per ounce $1.767 Standard ounces per completed unit 12 Actual ounces purchased and used in production 11,186 Actual price paid for materials $22,931 Labor: Standard hourly labor rate $14.92 per hour Standard hours allowed per completed unit 4.0 Actual labor hours worked 4,661 Actual total labor costs $75,741 Overhead: Actual and budgeted fixed overhead $1,189,000 Standard variable overhead rate $28.00 per standard labor hour Actual variable overhead costs $130,508 Overhead is applied on standard labor hours. (Round interim calculations to the nearest cent.) The direct labor rate variance is a.$21,730.60 favorable b.$6,199.13 unfavorable c.$21,730.60 unfavorable d.$6,199.13 favorable

Answers

Answer:

Direct labor rate variance= $6,199.13 unfavorable

Explanation:

Giving the following information:

Labor:

Standard hourly labor rate $14.92 per hour

Actual labor hours worked 4,661

Actual total labor costs $75,741

To calculate the direct labor rate variance, we need to use the following formula:

Direct labor rate variance= (Standard Rate - Actual Rate)*Actual Quantity

Actual rate= 75,741/4,661= $16.25

Direct labor rate variance= (14.92 - 16.25)*4,661

Direct labor rate variance= $6,199.13 unfavorable

When harvesting a venture, the outright purchase of the going concern by managers, employees, or external buyers is known as going public. Question 2 options:

Answers

Answer:

In simple words, Harvesting seems to be the tool used by traders and investors to get out of business and, preferably, to recover the interest of their investments in the company. It's about more than trying to sell and having to leave a company. It includes collecting interest, risk reduction, and developing opportunities for the future.

Whenever a marketing plan includes a harvest tactic, investment firms and borrowers are convinced that the proprietors aim to establish the market and start selling it to either international shareholders or go to another corporation.

The ratio of sales to invested assets, which is also a factor in the DuPont formula for determining the rate of return on investment, is called

Answers

Answer:

Investment turnover

Explanation:

Investment turnover is used to compare the revenue earned by a business to the invested assets (equity or debt). It measures how effectively the business is using investment to generate profit.

The number of times investment is converted to revenue is calculated using this method (that is the turnover).

This metric is used in the Dupont formula.

Dupont formula is a financial ratio that evaluates a company's ability to increase return on equity.

Three main components of the Dupont formula are: profit margin, total asset turnover, and financial leverage.

On July 1, Shady Creek Resort borrowed $400,000 cash by signing a 10-year, 9% installment note requiring equal payments each June 30 of $62,328. What is the journal entry to record the first annual payment

Answers

Answer:

                             Journal Entry

                                    Debit       Credit

Interest Expense      $36,000

Notes Payable          $26,328

Cash                                             $62,328

Workings

Interest portion for one year = 400,000 * 9% = $36,000

Total installment paid = $62,328

So, principal portion repaid = $62,328 - $36,000

 = $26,328

eally Great Corporation manufactures industrial−sized landscaping trailers and uses budgeted machine−hours to allocate variable manufacturing overhead. The following information pertains to the​ company's manufacturing overhead​ data: Budgeted output units 51,000 units Budgeted machine−hours 10,200 hours Budgeted variable manufacturing overhead costs for 51,000 units $387,600 Actual output units produced 35,750 units Actual machine−hours used 14,300 hours Actual variable manufacturing overhead costs $328,900 What is the budgeted variable overhead cost rate per output​ unit?

Answers

Answer:

$7.60 per unit of output

Explanation:

Budgeted output units 51,000 units

Budgeted machine−hours 10,200 hours

Budgeted variable manufacturing overhead costs for 51,000 units $387,600

budgeted variable overhead cost per unit of output = $387,600 / 51,000 units = $7.60 per unit of output

In this case, the applied variable overhead rate = 35,750 units x $7.60 = $271,700, which would have been under-applied since the actual variable overhead costs were much higher, $328,900.

The Watkins Company is​ decentralized, and divisions are considered investment centers. Watkins specializes in sports​ equipment, and one division manufactures netting that is used for basketball​ hoops, soccer​ goals, and other sports equipment. The Netting Division reports the following information for a​ heavy-duty basketball hoop​ net:

Sales Price per Unit $18
Variable Cost per Unit 6
Contribution Margin per Unit 12

The Basketball Equipment Division can purchase a similar heavy-duty net from an outside vendor for $15.

Required:

a. Determine the negotiable range for the transfer price.
b. What is the minimum transfer price the Netting Division should consider if operating at capacity?
c. What is the maximum transfer price the Basketball Equipment Division should consider?

Answers

Answer and Explanation:

a. The negotiable range for the transfer price is lies between the $6 and $18 as the netting division is suffering from losses if the selling price is less than the variable cost per unit but at the same time the maximum price for transferring the product is equivalent to the selling price i.e $18

b. The minimum transfer price is $18 in the case when operating at capacity if it is below than the minimum transfer price is $6

c. The maximum transfer price should be equivalent to the purchase price that is purchased from the outside vendor i.e $15

You purchased a stock at a price of $48.98. The stock paid a dividend of $1.63 per share and the stock price at the end of the year was $54.12. What was the total return for the year? Multiple Choice 13.82% 10.49% 13.17% 12.51% 3.33%

Answers

Answer:

13.82%

Explanation:

The computation of total return for the year is shown below:-

Total return = (End value - Beginning value + Dividend) ÷ Beginning value

= ($54.12 - $48.98 + $1.63) ÷ $48.98

= 6.77 ÷ $48.98

= 0.13821

or

= 13.82%

Therefore for computing the total return we simply applied the above formula by considering all the information given in the question

Debra and Merina sell electronic equipment and supplies through their partnership. They wish to expand their computer lines and decide to admit Wayne to the partnership. Debra's capital is $200,000, Merina's capital is $160,000, and they share income in a ratio of 3:2, respectively.Required:Record Wayne's admission for each of the following independent situations:a. Wayne directly purchases half of Merina's investment in the partnership for $97,000.b. Wayne invests the amount needed to give him a one-third interest in the partnership's capital if no goodwill or bonus is recorded.

Answers

Answer:

a. Merina's captal is $160,000. Half would be $80,000.

Entry;

DR Merina, Capital ..................................................................$80,000

CR Wayne, Capital ....................................................................................$80,000

(To record purchase of half of Merina Capital)

b.

DR Cash......................................................................$180,000

CR Wayne, Capital.........................................................................$180,000

(To record Wayne investment)

Working

The current Capital amount is;

= 200,000 +160,000

= $360,000

If Wayne joins and adds to this such that he owns 1/3 then;

2/3x = 360,000

x = 360,000/2/3

x = $540,000

Wayne's share would be;

= 1/3 * 540,000

= $180,000

The journal entries that would take place will take effect as A- A debit in Merina's capital amount and Cash account as $17000 and a credit effect in Wayne's capital account. The amount of debit and credit will be $97000.

And for B- There will be Debit in Cash account effecting a credit in The Wayne's capital account. The amount effecting the debit and credit side will be $180,000.

The journal entries are added in the images attached to the answer. The entries would take place in the journal entries on the respective date of their occurrence.( Image attached below).

When Wayne is introduced as partner for one third share the calculation of the amount of his capital would be shown as considering the capital as x. The capital by existing partners is $360000. (Image below).

,[tex]\dfrac{2}{3}x\ = 360000[/tex]

[tex]x= \dfrac {360000}{\dfrac{2}{3}}[/tex]

Now the value of x will be calculated as

[tex]x= \dfrac{540000}{3}[/tex]

[tex]x=180000[/tex]

Therefore Wayne's capital will be calculated as $180,000, so he will be required to bring in additional $180,000 capital in the firm for getting one third share in the profits and losses of the company.

Hence, the correct statements for A will be that Wayne pays $97000 which will be divided in Merina's capital and cash accounts in the proportion of $80000 and $17000 respectively.

To know more about partnership firm, click the link below.

https://brainly.com/question/6346527

If the cost of labor decreases the isocost line will A. stay the same. B. shift inward in parallel fashion. C. rotate outward around the point where only capital is employed in production. D. shift outward in parallel fashion.

Answers

Answer:

C. rotate outward around the point where only capital is employed in production.

Explanation:

Other Questions
A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting