Jill has two dimes she is going to use to perform a probability experiment. What will the sample space look like if she flips the two dimes simultaneously?

Answers

Answer 1
The Answer is that they will end up on the same side

Related Questions

A basin is filled by two pipes in 12 minutes and 16 minutes respectively. Due to the obstruction of water flow after the two pipes have been running together for some time, the 1st pipe carries 7/8 of the carrying capacity and the 2nd pipe carries 5/6 of the carrying capacity. After removing the water barrier, the tank is full in 3 minutes. How long after the flow of water in the two pipes became normal?​

Answers

Answer:

The time duration of the two pipes restricted flow before the flow became normal is 4.5 minutes

Step-by-step explanation:

The given information are;

The time duration for the volume, V, of the basin to be filled by one of the pipe, A, = 12 minutes

The time duration for the volume, V, of the basin to be filled by the other pipe, B, = 16 minutes

Therefore, the flow rate of pipe A = V/12

The flow rate of pipe B = V/16

Due to the restriction, we have;

The proportion of its carrying capacity the first pipe, A, carries = 7/8 of the carrying capacity

The proportion of its carrying capacity the second pipe, B, carries = 5/6 of the carrying capacity

Whereby the tank is filled 3 minutes after the restriction is removed, we have;

[tex]\dfrac{7}{8} \times \dfrac{V}{12} \times t + \dfrac{5}{6} \times \dfrac{V}{16} \times t + \dfrac{V}{12} \times 3 + \dfrac{V}{16} \times 3 = V[/tex]

Simplifying gives;

[tex]\dfrac{(2\cdot t +7) \cdot V}{16} = V[/tex]

2·t + 7 = 16

t = (16 - 7)/2 = 4.5 minutes

Therefore, it took 4.5 seconds of the restricted flow before the the flow of water in the two pipes became normal

hope the answer above helped bro! it helped me!

(07.05 LC)

Which statement is true for the equation 4n − 3 = 4n − 2?

It has no solution.
It has one solution.
It has two solutions.
It has infinitely many solutions.

Answers

Answer:

The answer is (A); there is no solution.

Step-by-step explanation:

It doesn't require any calculations, really, just logic.  Look, 4n = 4n wil be equal because they are the same numbers multiplied by the same variable - no matter the variable's value.  However, if you subtract both values by different numbers, you won't get the same number:

Let's say n = 5

4n = 4n

= 4(5) = 4(5)

= 20 = 20

Now,

4n - 3 = 4n - 2

= 4(5) - 3 = 4(5) - 2

= 20 - 3 = 20 -2

= 17 ≠ 18

Hope this helps!  Tell me if I was wrong!

Answer:

It has no solution.

Step-by-step explanation:

If we try and solve it we end up with nonsense, so it has no solutions:

4n - 3 = 4n - 2

4n - 4n = - 2 + 3

0 = 1

-  which is, of course, absurd.

Also, just by looking at the equation we can see that  the term 4n  -3  cannot in any way be equal to 4n - 2.

5. The cost of movie tickets at the
Cinema Verite is 9 dollars for adults
and five dollars for children under 12.
During the Saturday and Sunday
matinees, adults are charged 8 dollars
for admission and children under 12
are charged 4 dollars. At any time at
all, there is a group discount for groups
of 15 or more adults at a cost of 6
dollars per ticket. What is the cost for 2
adults and 3 children during the
Saturday matinee?
a. 27
b. 28
C. 14
d. 32

Answers

Answer:

its 28 dude, because it says that adults and children are played more on saturday.(adults on Saturday=$8 and children under 12 are $4

B because more adults and children played on saturday.

Which of the following are exterior angles? Check all that apply.
6
52
3
O A. 21
O B. 25
O c. 24
O D. 23
E. 22
O F. 26

Answers

Using it's concept, it is found that the exterior angles of the triangle are given as follows:

B. <5

C. <4

What are the exterior angles of a triangle?

The exterior angles of a triangle are the angles that are outside the triangle.

In this problem, the angles are 4 and 5, which means that options B and C are correct.

More can be learned about the exterior angles of a triangle at https://brainly.com/question/2546141

#SPJ1

Determine whether each sequence is a geometric sequence. If yes, then state the common ratio.
5, 10, 15, 20,...

Answers

Answer:

Step-by-step explanation:

it is not a geometric sequence

Answer:

no

Step-by-step explanation:

Take the second  term and divide it by the first term

10/5 = 2

Take the third term and divide it by the second term

15/10 = 3/2

The ratio is not the same so it is not a geometric sequence


The frequency table above is presented as a pie chart
The sectorial angle of score"3" is ....

Answers

Answer:

[tex]Angle = 96[/tex]

Step-by-step explanation:

Given

The frequency table

Required:

Determine the sectorial angle of "3"

First we need to determine the total frequency;

[tex]Total = 3 + 4 + 6 +8 + 5 + 4[/tex]

[tex]Total = 30[/tex]

The sectorial angle is calculated as thus;

[tex]Angle = \frac{Frequency}{Total\ Frequency} * 360[/tex]

Where Frequency of "3" = 8

So;

[tex]Angle = \frac{8}{30} * 360[/tex]

[tex]Angle = \frac{8* 360}{30}[/tex]

[tex]Angle = \frac{2880}{30}[/tex]

[tex]Angle = 96[/tex]

Hence; the sectorial angle of "3" is 96

An exponential function f(x)= ab^x passes through the points (0,10) and (3,1250). What are the values of a and b?

a = I know it’s 10
b = ?

Answers

Answer:

a = 10 and b = 5

Step-by-step explanation:

We write out f(x)= ab^x for x = 0 and x = 3 to create two equations in a and b that must be solved simultaneously:

(0, 10):  10 = a*b^0

This tells us that 10 = a*1, or a = 10.

(3, 1250):  1250 = a*b^3 => 10*b^3, or

1250 = 10*b^3, or

125 = b^3.  Taking the cube root of both sides, we obtain b = 5.

a = 10 and b = 5

a = 10 and the next would probably be b=5

Use the graph to determine the vertex point of the quadratic function. Is the vertex a
maximum or a minimum?

Vertex (1,3),maximum
Vertex (3,1) minimum
Vertex (1,3),minimum
Vertex (3,1) maximum

Answers

(3, 1) minimum

It is a minimum because it is at the bottom, whereas a maximum would be at the top. The coordinates are read off the graph to find the point.

Answer:

Vertex (3,1) minimum

Step-by-step explanation:

Hello, I attached a graph with two examples where you can see the Vertex and when this is a minimum vs maximum.

You can see in your graph that the vertex is the point (3,1) and this is a minimum.

Hope this helps.

Do not hesitate if you need further explanation.

Thank you

The five-number summary for the number of touchdowns thrown by each quarterback in the British Football League is shown in the following table. About what per cent of quarterbacks in the British Football League threw more than 13 touchdowns?

Answers

Answer:

❁ 25% ❁

Explanation:

❁ The answer would be 25% ❁

Solve the equation 14=7(2x-4) using two different methods. Show your work. Which method do you prefer? Explain. need help thanks

Answers

Answer:

x=3

Step-by-step explanation:

14=7(2x-4)

14/7=2x-4

2=2x-4

2x=2+4

2x=6

x=6/2

x=3

------------

14=7(2x-4)

14=14x-28

14x=14+28

14x=42

x=42/14

x=3

The equation 14 = 7(2x - 4) can be solved using two different methods: the distributive property method and the inverse operations method. Both methods yield the same solution, which is x = 3. The preference between the two methods depends on personal preference and the specific equation being solved.

Distributive Property Method:

We'll distribute the 7 to the terms inside the parentheses:

14 = 7(2x - 4)

14 = 14x - 28

Next, we'll isolate the variable term:

14x = 14 + 28

14x = 42

Finally, we'll solve for x by dividing both sides of the equation by 14:

x = 42/14

x = 3

So the solution to the equation is x = 3.

Inverse Operations Method:

We'll use inverse operations to solve the equation step by step:

14 = 7(2x - 4)

Divide both sides of the equation by 7 to isolate the term in parentheses:

14/7 = 7(2x - 4)/7

2 = 2x - 4

Add 4 to both sides of the equation to isolate the variable term:

2 + 4 = 2x - 4 + 4

6 = 2x

Divide both sides of the equation by 2 to solve for x:

6/2 = 2x/2

3 = x

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ2

Plz I need the answer ASAP.

Answers

Answer:

-10

Step-by-step explanation:

The reason why I believe the answer to your question is -10 is because inequality represents the difference in size, degree, circumstances, etc.; lack of equality. So I had to find the difference between -5 and 5, and -5 minus 5 is -10.

Also if this helps, it would be nice if you gave brainlest :)

Anwser is -10 sorry I was slow

What is the volume of the following rectangular prism?


I’m doing this on khan academy and I keep failing the test. Now I’m scared of getting questions wrong

Answers

Answer:

8 1/8

Step-by-step explanation:

V = 16 1/4 • 1/2

V = 8 1/8

Answer:

8 1/8 units³

Step-by-step explanation:

V = lwh

Since the area is already given to you, just multiply that by the other number.

[tex]V=(16\frac{1}{4})(\frac{1}{2})\\\\V=\frac{65}{8}=8\frac{1}{8}[/tex]

Find f-1.
f(x)=4 log2 (x – 7)

Answers

Answer:

f(1) = 10.33985 + 18.1294406 i

Step-by-step explanation:

f(1) = 4log2(1-7)

f(1) = 10.33985 + 18.1294406 i

f(1)= 10.33985+ 18.1294406
i think

Use the drawing tool(s) to form the correct answer on the provided number line.
Will brought a 144-ounce cooler filled with water to soccer practice. He used 16 ounces from the cooler to fill his water bottle. He then took
out 16 plastic cups for his teammates and put the same amount of water in each cup.

Answers

Answer:

Kindly see explanation

Step-by-step explanation:

Given the following :

Amount of water in cooler = 144 ounces

Size of Will's water bottle = 16 ounces

Therefore, the amount of water left after filling his water bottle :

144 ounces - 16 ounces = 128 ounces of water.

The 128 ounces left was used to equally fill 16 plastic cups :

Therefore the number of ounces of water put in each cup equals :

(128 ounces ÷ 16 cups) = 8 ounces.

The maximum number of ounces of water will could have put in each cup is 8 ounces

Thus (0 < x ≤ 8)

See graph below

Very fascinating answer

I am a four digit number

I am a multiple of 110

My second and fourth digit are the same.

The first digit is one more than my third digit

Please help me with this riddle! :)!

Answers

The answer is 2090 please trust me

PLEASE HELP ME!! I WILL GIVE BRAINLIEST!!

Find the output, y, when the input, x, is -5.

Answers

Answer:

[tex]\boxed{y = -2}[/tex]

Step-by-step explanation:

Hey there!

To find y when x is -5 we go to -5 on the x-axis.

When at -5 find where the blue line is vertical to -5,

which is -2.

Hope this helps :)

The Answer is:

y = - 2

If g(x) = 1 - ¾ x
find: g(0)

Answers

[tex] \sf \: g(x) = 1 - \frac{3}{4} x \\ \sf \:g(0) = \: ? \\ \\ \sf \: Substitute\: the \: value \: of \: x \: as \: 0 \\ \\ \sf \:1 - \frac{3}{4} (0) \\ \sf \: = 1 - \frac{3}{4} \times 0 \\ \sf \: = 1 - 0 \\ \sf \: = \underline{\bf \: 1}[/tex]

Hope it helps.

RainbowSalt2222

I honestly don’t know

I don't understand this question, somebody help

Answers

Answer:

H. 50 sq cm

Step-by-step explanation:

Triangle PSU is an equilateral triangle because each side of it is a radius of semicircle TRP. Also, the radius of semicircle TRP is the short side of the rectangle. So, if the total perimeter of the triangle is 15, each side is 5 cm. So, the short side of the rectangle is 5cm and the long side is 5*2 = 10 cm.

5 * 10 = 50 sq cm

i need points really bad so yea

solve by factoring
x^2-8x= -15

Answers

Answer:

(5,0)(3,0)

Step-by-step explanation:

x^2 - 8x + 15 = 0

(x - 5)(x - 3) = 0

x - 5 = 0

x = 5

x - 3 = 0

x = 3

(5,0) (3,0) hope this helps

TELL ME THE FORMULA FOR VOLUME AND SURFACE AREA OF PRISMS

Answers

Answer:

surfacevolume = 1/2 (bh) l

surfacearea = bh + pl

So the answer is bh plus pl and I hopes this help good luck

a. How many non-degenerate scalene triangles with integer sides have a

perimeter of 27?


b. A square is inscribed in an equilateral triangle of side length 2 so that

two adjacent corners of the square lie on two sides of the triangle, and

the third side of the triangle contains one side of the square. The area of

the region inside the triangle and outside the square can be expressed as

a√b − c. What is a + b + c?

Answers

Answer:

Hello,

a)18

Step-by-step explanation:

[tex]p=27, int[p/2]=13\\\\\begin{array}{c|c|c|c|c}a&p-a&b&c\\---&---&---&---\\1&26&13&13\\2&25&12&13\\3&24&12&12\\4&23&10&13\\&&11&12\\5&22&9&13\\&&10&12\\&&11&11\\6&21&8&13\\&&9&12\\&&10&11\\7&20&7&13\\&&8&12\\&&9&11\\&&10&10\\8&19&8&11\\&&9&10\\9&18&9&9\\---&---&---&---\\\end{array}[/tex]

number of triangle=18

b)

Side of the equilateral triangle =2

Height=√3 (using Pythagorean's theorem) (tr ACP)

Triangle ABJ has the same area as the triangle ABC

Uisng Thalès's theorem,

[tex]\dfrac{2-v}{2}=\dfrac{v}{\sqrt{3} } \\\\\\v=\dfrac{2\sqrt{3} }{2+\sqrt{3} } \\\\\\v=\dfrac{2\sqrt{3}*(2-\sqrt{3}) }{1} } \\\\v=4\sqrt{3}-6\\\\v^2=84-48\sqrt{3} \\Area =a\sqrt{b}-c= \sqrt{3} -(84-48\sqrt{3} )=49\sqrt{3} -84\approx{0,87049...}\\\\So:\\b=3\\a=49\\c=84\\\\a+b+c=3+49+84=136\\[/tex]

This all equal 136 I had it

plsss help meeeeeee!!!! Jakes club has 35 members. it's rules require that 60% of them must be present for any vote. at least how many members must be present to have a vote?

Answers

Answer:

21 members

Step-by-step explanation:

Jake's club

Total number of members = 35

percentage of members required to be present for any vote = 60%

= 60/100 × 35

= 0.6 × 35

= 21

At least 21 member must be present

PLEASE HELP PLEASE WILL MARK BRAINLY

Answers

Answer:

15, 5, 45, 10

Step-by-step explanation:

2 minutes for 10 photos

1 minute for 5 photos

now:

2×5=10

3×5=15

25÷5=5

9×5=45

50÷5=10

15 5 45 10
You’re welcome

A textbook is 14/15 inch thick. How many
textbooks can be stacked on a shelf that is
56 inches high?

Answers

Answer:

60 textbooks

Step-by-step explanation:

1) 56*15:14=60

Answer:

60 textbooks

Step-by-step explanation:

To get the answer, you have to divide 56 by 14/15. What I'd do is id think of 56  

as 56/1. I'd change 14/15 into a multiplicative inverse/reciprocal, ending up with 15/14. From there, id multiply 56/1 and 15/14, ending up with 840/14.Using long division, id do 840 divided by 14, ending up with 60.

write the formula used to find length when the breadth height and volume are known........breadth when the length height and volume are known............ height when the breadth length and volume are known ..............Please answer this as fast as possible my homework is due tommorow

Answers

Answer: L = V/bh

b= V/Lh and h= V/Lb

Step-by-step explanation: V = Lbh or V= lwh is also used for the Basic form for the Volume of a cube or rectangular prism is

Volume = Length × breadth × height

The volume will be expressed as cubic units such as cubic meters cubic feet. Sometimes abbreviations are used like cm^3 for cubic centimeters.

When you know the Volume, and you need to find a missing dimension, just make a fraction with the V in the numerator and the dimensions you know in the denominator. This means you are dividing the Volume by the area of the dimensions you have been given to find the missing dimension.

Your answer will be fine

What is the best estimate of the sum of $14.30, $143.08, and $19.74

Answers

Answer:

Step-by-step explanation:

ok so you start off by adding

  14.30

143.08

  19.74

 177.12

177.12 is close to 180 if u estimate in tens, 177 if ones

The addition of the numbers $14.30, $143.08, and $19.74 will be $177.12.

What is Algebra?

The analysis of mathematical representations is algebra, and the handling of those symbols is logic.

All real numerals and 0 are included in the category of whole numbers.

The process of adding up the different or more sums or figures.

The sum means plus sing is present between the terms.

The whole numbers are given below,

$14.30, $143.08, and $19.74

Then the summation of the whole numbers is given below.

⇒ $14.30 + $143.08 + $19.74

⇒ $177.12

Thus, the addition of the numbers $14.30, $143.08, and $19.74 will be $177.12.

More about the Algebra link is given below.

https://brainly.com/question/953809

#SPJ2

Using the GCF and distributive property, which expressions is equivalent (equal) to 12y + 16

A 2(6y + 80)

B 4(3y + 4)

C 28y

D 16 + 12y

Answers

Answer:

4(3y+4)

Step-by-step explanation:

12y + 16

4*3*y +4*4

Factor out 4

4(3y+4)

Answer:

2(6y+80) = 12y+160

4(3y+4) = 12y+16

28y = 28y

16+12y = 12y+16 (did not use distributive property)

So,  B is correct.

Let me know if this helps!

HELP HELP HELP HELP HELP HELP!!! What symbol is needed between –2 ? |–3| to make a true statement?

Answers

Answer:

[tex]\boxed{<}[/tex]

Step-by-step explanation:

[tex]-2 \ ? \ |-3|[/tex]

[tex]\sf Solve \ absolute \ value.[/tex]

[tex]|-3|=3[/tex]

[tex]-2 < 3[/tex]

[tex]\sf -2 \ is \ less \ than \ 3.[/tex]

Answer:

<

Step-by-step explanation:

|-3| = 3

-2 < 3

Which expression is equivalent to (0.5n−0.3)−(0.8n−0.9)?

Answers

Answer:

-0.3n + 0.6

Step-by-step explanation:

if we write out the entire expression we have:

0.5n - 0.3 - 0.8n + 0.9 (two negative signs create a positive sign)

then we add and subtract

and receive

-0.3n + 0.6

Answer:

-0.3n + 0.6

Step-by-step explanation:

We can eliminate the parentheses, obtaining:

0.5n - 0.3 - 0.8n + 0.9

and then combine like terms, obtaining:

-0.3n + 0.6

cqn someone answer this?​

Answers

Answer:

-3

Step-by-step explanation:

-11/2+27/4+(-17/4)(-22+27-17)/4(-12)/4-3

The anwser to your question would be negative 3
Other Questions
Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting A single-slit diffraction pattern is formed on a distant screen. Assuming the angles involved are small, by what factor will the width of the central bright spot on the screen change if the slit width is doubled?a. It will become four times as large.b. It will double.c. It will be cut in half.d. It will become eight times as large.e. It will be cut to one-quarter its original size. Show Work! A warehouse worker shipped 289 boxes of notebooks. Each box contained 36 notebooks. What was the total number of notebooks shipped?(A) 2, 601(B) 9, 404(C) 10, 404(D) 10, 413 Adnde ______ ustedes? Question 18 options: a) voy b) va c) van d) vamos 7. Characteristics of a newsworthy incident include: timeliness, proximity, prominence, uniqueness, human interest, and: A. Visual interest B. Conflict C. Media agenda D. An easily understood situation Write the equation for each question: 9. the sum of 5 and four times a number is 3210. four less than the square of a number is 1211. The product of 3 and four more than a number is 20Marking Brainliest -3(-5x-2u+1) use the distributive property to remove the parentheses A bio catalyst that increases the rate of the reaction without being changeda) Aluminum oxide. b) Silicon dioxide. c) Enzyme. d) Hydrogen peroxide43. What is thethan the reaction substrate.42. A If Ab = 54, find MC.