On January 1, 2019, Providence, Inc., Issues $1,000,000 of 10 percent, 5-year bonds at par value. Complete the necessary journal entry by selecting the account names from the drop-down menus and entering the dollar amounts in the debit or credit columns. View transaction list Journal entry worksheet On January 1, 2019, Providence, Inc., Issues $1,000,000 of 10 percent, 5-year bonds at par value. Note: Enter debits before credits Date General Journal Debit Credit Jan 01

Answers

Answer 1

Answer:

01-Jan-19

Dr Cash $1,000,000

Cr Bonds Payable $1,000,000

Explanation:

Preparation of the Journal entry for Providence, Inc

Based on the information given we were told that the company issues the amount of $1,000,000 of 10% which include 5-year bonds at par value on January 1, 2019, this means that the Journal entry will be recorded as:

01-Jan-19

Dr Cash $1,000,000

Cr Bonds Payable $1,000,000

(To record bonds at par value)


Related Questions

Help Wanted Ads Established company seeking full-time residential house cleaner. We will train. Must be honest and dependable. Call (123) 456-7890. Suburban medical facility seeking surgeon. Board Certified required. $1,000 signing bonus for every year of experience, up to $15,000. Send resume to 123 Medical Drive, Suburbia, GA. Temporary lifeguard needed to fill summer holiday shifts at outdoor swimming pool Must have CPR and Lifeguard certification. Apply in person to Bridgefront, 123 Bridgefront, Anytown, GA. Aircraft manufacturer seeking engineers with advanced degree in physics and no less than 15 years experience. Many positions available. Send resume to 123 Aircraft Blvd., Anytown, GA. According to the help wanted ad for a surgeon, how many years of experience will provide the LARGEST signing bonus?
A) 0-4 years
B) 5-9 years
C) 10-14 years
D) 15+ years​

Answers

Answer: D 15+ years

Explanation:

The more years the larger the sign bonus

A woman held fee simple title to a vacant lot adjacent to a business. She was persuaded to make the lot available to the business. She had her attorney prepare a deed that conveyed ownership of the lot to the business "so long as it is used for commercial purposes." After the completion of the gift, the business will own a:___________.a. life estate.b. tenancy for years.c. periodic tenancy.d. determinable fee estate.

Answers

Answer:

D. Determinable fee estate

Explanation:

To begin, a determinable fee estate is structured such that it terminates upon the occasion of certain events, or completion of purpose, and will revert to the grantor without any entry or other provisions. This revert to the grantor is essential and thus come automatically, especially upon the creation of a determinable fee estate.

Given the scenario under study, a woman held a fee simple to a vacant lot adjacent to a business. Subsequently, she made the lot available to the business, and convey its ownership on same. The clause 'so long it is used for commercial purposes' further underscores that a determinable fee and/or future interest is expected to be earned on such.

This arrangement and especially looking at the completion of the gift, the business will thus own a Determinable fee estate.

Megan is a graduate student pursuing a course in business. Presented with the case of a company's unethical behavior, Megan wonders if the company's board of directors should ask the CEO to step down. Having a strong belief in Michael Porter's idea of value creation, Megan is most likely to conclude that company's board of directors:_________ A) should not ask the CEO to step down because doing so would cause a profit dip that would affect its shareholders. B) should ask the CEO to step down because it has a greater obligation toward society. C) should not ask the CEO to step down because he was responsible for an almost 90 percent appreciation of the company's stock. D) should ask the CEO to step down because agents, unlike principals, are disposable.

Answers

Answer:

B) should ask the CEO to step down because it has a greater obligation toward society.

Explanation:

The concept of value creation in a business is more than simply increasing profits, it is about creating value for the company's customers and society as a whole. This concept is best illustrated by engaging in practices that reduce pollution or other business decisions like not buying from foreign vendors that employ forced child labor. Sometimes certain business practices are so evil that they are outlawed, e.g. buying conflict or blood diamonds, but Belgian diamond markets are still full of them. The final decision is ours, and as customers we have the power to decide which companies we support.

On the statement of cash flows, the investing activities section would include a.cash paid for retirement of bonds payable b.cash received from the issuance of capital stock c.cash paid for dividends d.cash received from the sale of investments

Answers

C I think is the right answer

Which organization does not work for consumers
Federal trade comission
Food and drug administration
Federal treasury
Better business bureau

Answers

Answer:

Which organization does not work for consumers

Federal treasury

Explanation:

The other three are consumer-focused.  But the Federal Treasury is a US government agency that advises government on fiscal matters.  It performs some law enforcement activities to help government enforce laws on fiscal policies.  It is also responsible for manufacturing the currency and postage stamps.  Finally, it has responsibility for the supervision of national banks in the United States.

Answer:

It might b

Explanation:

The marketing manager from a heavy-equipment manufacturer in Dallas,Texas was attending an international trade show in Japan.There were many prospective customers from different countries who seemed interested in the firm's product.However,they had difficulty following the manager's explanations of product features due to his heavy Texas drawl.In this case,the accent would be considered:__________.
A) an encoding error
B) a decoding error
C) culture shock
D) noise
E) distortion

Answers

Answer:

D) noise

Explanation:

Since it is mentioned in the question that there were many possible customers who belong from different countries are seemed interested in the firm product but at the time when the manager explained the features of the product, there was difficulty due to heavy Texas drawl.

So this situation represents the noise and hence the same is to be considered

Mr. Henshaw, CEO of MBA Bank, decides that the organization needs to provide more convenient service to customers. He decides to increase the bank's service hours from 8 hours a day, Monday through Friday, to 12 hours a day, plus 8 hours a day each weekend day. He has his assistant compile a report that gives data on how the number of open hours of many banks is correlated with their customers' satisfaction, and presents the data to his executive committee. What stage of Lewin's change process is Mr. Henshaw operating in?

Answers

Answer: unfreezing

Explanation:

The unfreezing stage of Lewis change process is being regarded as the first stage of change, and in this stage, an organization is being prepared and accept that change is inevitable and necessary and that existing status quo should also be broken.

This is illustrated in what Mr. Henshaw, CEO of MBA Bank did, by deciding that the organization needs to provide more convenient service to customers.

Father Christmas is a retail store that sells a unique Santa made from fur, wool, and tapestry. Of 150 customers wish to buy a Santa from this store, and it sells 120 before running out of stock, what is its service level

Answers

Answer:

80%

Explanation:

Calculation for the service level

Using this formula

Service level=Sales/Numbers of customers

Let plug in the formula

Service level=120/150

Service level=0.8*100

Service level=80%

Therefore the service level will be 80%

The reserve requirement is​ 10%. Suppose that the Fed ​$ worth of U.S. government securities a bond​ dealer, electronically the​ dealer's deposit account at Reliable Bank. Which of the following correctly describes the immediate effect of this​ transaction? A. The total reserves of Reliable Bank by ​$. B. The excess reserves of Reliable Bank by ​$. C. The required reserves of Reliable Bank by ​$. D. Reliable Bank

Answers

Answer:

D. The money supply decreases by ​$150,000.

Explanation:

Note: This question is not complete as some figures are omitted. The full question is therefore presented first before answering the question as follows:

The reserve requirement is​ 10%.

Suppose that the Fed sells ​$150,000 worth of U.S. government securities from a bond​ dealer, electronically debiting the​ dealer's deposit account at Reliable Bank.

Which of the following correctly describes the immediate effect of this transaction on the money​ supply?

A. The money supply decreases by ​$1,500,000

B. The money supply decreases by ​$135,000.

C. There is no change in the money supply.

D. The money supply decreases by ​$150,000.

E. None of the above.

The explanation to the answer is now provided as follows:

This is an example of Open market operations (OMO).

Open market operations (OMO) is a monetary policy strategy in which the central bank such as the Federal Reserve sells or purchases government securities in order to implement a particular monetary policy.

When the central bank sells government securities on the open market, it aims to reduce the money supply by the worth of the securities. This is called a contractionary monetary policy.

On the other hand, when the central bank purchases government securities on the open market, it aims to increase the money supply by the worh of the government securities. This is called an expansionary monetary policy.

From the question, the sale of ​$150,000 worth of U.S. government securities from a bond​ dealer is a contractionary monetary policy and it will reduce the money supply by exactly $150,000.

Therefore, the correct option is D. The money supply decreases by ​$150,000.

1. What types of the goods have elastic demand-
i. Non-essential or essential goods?
1. More substitutes or less substitutes?

Answers

Answer:

i.Non essential goods

ii.More substitute

A client has a third-degree burn on the leg. The wound is being treated by the open method. After about 4 days, a hard crust has formed around the leg and is impairing the circulation to the leg. What procedure would be done to relieve pressure on the affected area?
A. escharotomy
B. debridement
C. allograft
D. silvadene application

Answers

your answer is third hope it's helpful to you

Allograft procedure would be done to relieve pressure on the affected area.

What is Allograft?

Allograft refers to the transplant of an organ or tissue from one person of the same species to another with a different genotype. For instance, an allograft is a transplant from one individual to another who is not an identical twin. Many human transplants, including those involving cadaveric, live related, and living unrelated donors, use allografts. also referred to as a homograft or an allogeneic graft.

Allografts can be used in a variety of conditions with varied degrees of severity. For instance, bone allograft transplants can be utilized for more cosmetic purposes in dentistry or plastic surgery, as well as to repair limbs in orthopedics.

Allograft transplants can be employed both during the operation and directly for the treatment of patients. A type of bone putty created from donated bone or tissue material is called a demineralized bone matrix. Musculoskeletal allograft transplants are the most popular kind of allograft transplants.

This relates to one of the primary justifications for the use of allograft transplants: synthetic materials can have characteristics that differ from those of biologically human tissue and may not be appropriate for the intended application. In addition, tissue from an allograft transplant usually fuses with the recipient's own tissue over time, becoming an indistinguishable component of the recipient's body. If one's own tissue cannot be used in sufficient quantities, allograft transplants may be employed.

Tissues can be prepared for allograft transplantation using a variety of techniques. To get rid of as many cellular components as feasible, the tissue is treated with antibiotics, and detergents during aseptic processing.

It is also possible to chemically sterilize allograft tissue using the sterilization process. Gamma irradiation, a type of electromagnetic radiation that purges the tissue of microorganisms, is frequently combined with this. However, viruses might not be eliminated by gamma radiation.

Hence, correct option is C.

To learn more about allograft, click here
https://brainly.com/question/453869?
#SPJ2

"Two unrelated persons (Person A and Person B) come into your branch office to open a new account. They tell you that the funds are being deposited by Person A, who will be the owner of the account, and that Person B wants to be able to trade the account. They also tell you that only 1 social security number is to be used on the account. How should the account be opened?"

Answers

Answer: Individual account in the name of Person A with a Third Party Trading Authorization granted to Person B

Explanation:

An account that has two or more signatory is known as a joint account. When this account is opened, both parties or all signatory to the account will have to either be physically present or would provide details about about themselves to be used for opening of the account. The account is then opened and all signatory to the account can access and be informed about every detail about the account as there is no preference of one person over the other.

Timmy is a friend who came by your store after hours to have a beverage and play video games. When Timmy got up to use the restroom in the back of the store, he tripped over a raised piece of floor, causing him to fall and break his nose. You found out about the raised piece of floor yesterday, but you did not fix it because the restroom is for employees only. You owe Timmy:

Answers

Answer:

I owe him slip or trip compensation

Explanation:

The reason is that its shop owners responsibility to apply adequate duty of care so that other person don't get affected by the negligence of the shop owner. This negligence has resulted in breaking the nose of Timmy. Hence the shop owner owes Timmy slip or trip compensation and that he must repair that floor under the requirement of OSHA standards. The court may fine the shop owner for not having appropriate health and safety measures for the employees.

Self-insurance means:

Question 4 options:

A. Insuring your voice.


B. Buying health insurance.


C. Assuming your own financial risk for some of your property.


D. Buying extra insurance from your insurance company.

Answers

Answer:

assuming your own financial risk for some of your property

Answer:

Assuming your own financial risk for some of your property

Ashley, who makes knitted caps, determines that her marginal cost of producing one more knitted cap is equal to $10. A consumer offers her $12 if she sells one more knitted cap to her. Ashley will:

Answers

Ashley will get two extra dollars from making the cap that she sells if it costs her 10 to make a knitted cap and get paid 12 dollars that an extra 2 dollars per cap.

The recognition of the need for organizations to improve the state of people, the planet, and profit simultaneously if they are to achieve sustainable, long-term growth (Connect Chapter 4) is referred to as

Answers

Answer:

The need for organisations (which may be governmental or non-governmental) to improve the condition of living of people and protect their environment whilst they pursue increased profitability has been termed

The Triple Bottomline.

It is also referred to by economists as the 3P - People, Planet and Profit.

It speaks to the fact that other than the usual making financial success the sole metric of measurement by which organisations are evaluated, their impact on people and the environment should be considered as well.

In simple terms, a firm should be termed more successful than others if it's activities besides being profitable also impacts positively on people and protects if not improves the environment.

Cheers!

Which example below best describes a longitudinal design in a descriptive research project? A. A panel that consists of households that provide purchasing information at specified intervals over an extended period. B. Surveys involving 600 mall intercepts in six major cities to determine the likes and dislikes of health food. C. A variety of promotional offers would be displayed in stores, with each group of customers seeing only one offer and the resulting brand sales determined. D. None of the above

Answers

Answer:

A. A panel that consists of households that provide purchasing information at specified intervals over an extended period

Explanation:

Longitudinal design in research is a method that involves repeated examination of the same variables over a short or long term to see if there is any changes that occur.

A fixed sample is measured repeatedly to gain information.

A panel that consists of households that provide purchasing information at specified intervals over an extended period, is an example of longitudinal design.

The fixed sample is the panel of households, and they repeatedly provide purchasing information.

So the same sample is measured continuously over a period of time

A department mines the prior year’s data to determine if there are patterns related to absenteeism on a month-by-month basis. Which department (i.e. business function) benefits from this technology?

Answers

Answer:

The human resources / Payroll department

Explanation:

One of the function of human resources department is monitoring and evaluation of employee's performance. The rate of regularity of employees at work is highly relevant for this purpose and the prior years data on the absenteeism on a month - month basis could give an idea on whether they have been getting it right.

Another area is in the function of payroll. The attendance of employees at work is a major factor in arriving at the appropriate payroll. this function can also benefit from the prior years data to evaluate the accuracy of payroll activities.

As defined in the Uniform Securities Act, an investment adviser is all of the following except:_______. 1. a broker-dealer who charges for investment advice 2. a publisher of a financial newspaper 3. a person who sells security analysis 4. a CPA who, as an incidental part of his practice, suggests certain tax-sheltered investments to his affluent clients

Answers

Answer:

A publisher of financial newspaper

A CPA who as an incidental part of his practice , suggests certain tax sheltered investment to his affluent client

Explanation:

An investment adviser is a firm that is registered for the business of making investment recommendations or conduct securities analysis by managing clients assets and advising on potential investment in securities.

A publisher of financial newspaper and a CPA who as an incidental part of his practice , suggests certain tax sheltered investment to clients are not qualified as investment advisers under the uniform securities act.

You are considering acquiring a common share of Sahali Shopping Center Corporation that you would like to hold for 1 year. You expect to receive both $1.25 in dividends and $35 from the sale of the share at the end of the year. The maximum price you would pay for a share today is __________ if you wanted to earn a 12% return. A. $31.25 B. $32.37 C. $38.47 D. $41.32

Answers

Answer:

B. $32.37

Explanation:

The computation of the maximum price for paying the share today is shown below:

Let us assume the buying price be x

Now we applying the following formula

Return = (sale price - buy price + dividend) ÷ (buy price)

12% = ($35 - x + $1.25) ÷ x

0.12 = $36.25 - x

1.12x = $36.25

x = $36.25 ÷ 1.12

= $32.37

Hence, the correct option is B.

Gilbert & Sons is a leveraged firm. It has 300,000 shares of stock outstanding with a market price of $32 per share. The company also has $6.6 million of debt outstanding that sells at par. The pre-tax cost of debt is 9 percent and the unlevered cost of capital is 12 percent. What is the cost of equity if the tax rate is 35 percent?

Answers

Answer:

13.34%

Explanation:

According to the MM theory :

re = ro + (ro - rd)(1-t)D/E

where re = cost of equity

ro = unlevered cost of capital

t = tax rate

d/e = debt to equity ratio

equity = 300,000 x $32 = $9,600,000

D/E = $6.6 million / $9.6 million = 0.6875

12% + (12% - 9%) x (1-0.35) x 0.6875 = 13.34%

Palencia Paints Corporation has a target capital structure of 25% debt and 75% common equity, with no preferred stock. Its before-tax cost of debt is 13%, and its marginal tax rate is 40%. The current stock price is P0 = $22.00. The last dividend was D0 = $3.00, and it is expected to grow at a 5% constant rate. What is its cost of common equity and its WACC? Round your answers to two decimal places. Do not round your intermediate calculations.

Answers

Answer:

cost of common equity is 18.64%.

WACC is 15.93 %.

Explanation:

Cost of Equity is the return that is required by providers of Capital in form of Common Stocks.

This can be determined using the Growth Model as the information permits use of such method.

Cost of Equity = Current Dividend / Current Market Price + Expected Growth Rate

                       = $3.00 / $22.00 + 0.05

                       = 0.1864 or 18.64%

WACC = Ke × (E/V) + Kd × (D/V) + Kp × (P/V)

where,

Ke = cost of equity

    = 18.64%

E/V = Weight of Equity

      = 75%

Kd = cost of debt

     = Interest × (1 - market rate)

     = 0.13 × (1 - 0.40)

     = 0.078 or 7.80 %

D/V = Weight of Debt

       = 25%

Therefore,

WACC = 18.64% × 75% + 7.80 % × 25%

           = 15.93 %

Megan is a salesperson for a company that manufactures chemicals. While reviewing her new leads, Megan learned that two of them just signed contracts with one of her company's major competitors. Which of the following best describes why Megan will not consider these two leads as sales prospects?a. They do not have the budget or financial resources to purchase the product.b. They do not have a need for the products or services her company is offering.c. They are too busy to meet with salespeople.d. They do not have the authority to make a purchase decision.e. They are not in her company's target market.

Answers

Answer: They do not have a need for the products or services her company is offering.

Explanation:

From the question, we are informed that Megan is a salesperson for a company that manufactures chemicals and that while reviewing her new leads, she learned that two of them just signed contracts with one of her company's major competitors.

Megan will not consider these two leads as sales prospects because they do not have a need for the products or services her company is offering. This is because they signed a contract with their competitors.

Andy Seagroves purchased a computer from Best Buy. Best Buy did not disclose to him that the computer was a return item. There was no indication of any price difference between the computer Andy bought and the unopenedcomputers. Andy experiences significant difficulties with the computer and returns it to Best Buy. Andy indicates that he would like to have a new computer and that the price is now $150 more. Best Buy indicates that it is happy to take the return on the computer and credit Andy's account, but that it has no further liability.
a. Best Buy's position is correct.
b. Andy has no damages since Best Buy took back the computer.
c. Andy is entitled to recover the price difference so that he can replace the computer.
d. Andy is entitled to the return, but noadditional damages.
e. none of the above

Answers

Answer: c. Andy is entitled to recover the price difference so that he can replace the computer.

Explanation:

Most times when selling gadget integrity should be a watch word for many sellers. Selling a gadget knowing very well it has fault and not disclosing it to the buyer is a big offense that can and should be filed for a law suit if terms wanted are not met. Due to the damages that Andy got on the gadget on buying it, he is entitled to being paid the recovery price difference to get another laptop.

Marsh Corporation purchased a machine on July 1, 2012, for $1,250,000. The machine was estimated to have a useful life of 10 years with an estimated salvage value of $70,000. During 2015, it became apparent that the machine would become uneconomical after December 31, 2019, and that the machine would have no scrap value. Accumulated depreciation on this machine as of December 31, 2014, was $295,000. What should be the charge for depreciation in 2015 under generally accepted accounting principles

Answers

Answer:

$191,000

Explanation:

The computation of straight line depreciation is shown below:-

Straight line Depreciation:

= (Book value - Salvage value) ÷ Remaining life

= ($1,250,000 - $295,000 - 0) ÷ (From 2015 to 2019)

= ($1,250,000 - $295,000 - 0) ÷ 5 year

= $191,000

Therefore for computing the straight line depreciation we simply applied the above formula.

Nefchio is a popular website among online gamers. It uses interactive and collaborative features to create a richer, more interesting, and more useful experience for its users to beat the competition in the industry. In this scenario, Nefchio uses a new approach called _____.

Answers

Answer: Web 2.0

Explanation:

Web 2.0 are the websites that are easy to use, have participatory culture, utilize user-generated content for its end users.

This is the method used by Nefchio as we are informed that it uses interactive and collaborative features to create a richer, more interesting, and more useful experience for its users to beat the competition in the industry.

Organizations uses different kinds of approach. Nefchio uses a new approach called Web 2.0.

Web 2.0 is commonly referred to as participative/participatory web and social web. It is simply a type of websites that is based on user-generated content, ease of use, participatory culture etc., for its users.

It was created by Darcy DiNucci in 1999 and was said to be made popular by Tim O'Reilly and Dale Dougherty in 2004.

Learn more from

https://brainly.com/question/18756729

Since October 2008, the Federal Reserve has paid interest on excess reserves held by banks. Under these circumstances, if the Fed buys Treasury securities worth $300 million from a bank, how will the money supply be affected? Assume that the required reserve ratio is 10% and that all currency is deposited into the banking system.
A. The money supply will increase by less than $3 billion,
B. The money supply will increase by $3 billion
C. The money supply will not change at all
D. The money supply will increase by more than $3 billion

Answers

The statement "the money supply should increase by lower of $3 billion is correct.

The calculation is shown below:

Reserve requirement should be

= 10% of 3 million

= 0.3 million  

Now  

Excess reserve should be

= 3 - 0.3

= 2.7 million

Since  Required reserve ratio = 10%

Now  

Money multiplier is

= 1 ÷ Required reserve ratio

= 1 ÷ 0.10

= 10

So,

Increase in money supply should be

= 2.7 million × 10

= $2.7  billion.

So, the rest of the options should be incorrect.

Therefore we can conclude that the statement "the money supply should increase by lower of $3 billion is correct.

Learn more about the money supply here: brainly.com/question/1099440

We wish to develop a confidence interval for the population mean. The population follows the normal distribution, the standard deviation of the population is 3, and we have a sample of 10 observations. We decide to use the 90 percent level of confidence. The appropriate value of to represent the level of confidence is ________________.

Answers

The answer is supposed to be: -1.645

Fontaine and Monroe are forming a partnership. Fontaine invests a building that has a market value of $362,000; the partnership assumes responsibility for a $131,000 note secured by a mortgage on the property. Monroe invests $106,000 in cash and equipment that has a market value of $81,000. For the partnership, the amounts recorded for the building and for Fontaine's Capital account are:

Answers

Answer:

$362,000 building and $231,000 in Fontaine's capital account

Explanation:

Fontaine and Monroe are forming a partnership

Fontaine invests a building that has a market value of $362,000

The partnership assumes responsibility of $131,000 note

Monroe invests $106,000 in both cash and equipment

The market value is $81,000

Therefore, since the building has a market value of $362,000 then, the amount that is recorded for the building is $362,000

The amount recorded for Fontaine's capital account can be calculated as follows

= $362,000-$131,000

= $231,000

Hence the amount recorded in the building and Fontaine's capital account is $362,000 and $231,000 respectively

From June to the end of September, Jennifer wants to save at least $1,500. Her monthly expenses are $600. Jennifer saves whatever money she has left after paying her expenses each month. Jennifer is scheduled to work 80 hours in September. Find the minimum sales she needs in September to meet her goal of saving at least $1,500.

Answers

The minimum sales required by Jennifer to meet her savings goal must be $26.25 per hour or $2100 for September.

Given that,

Savings desired = $1500

Monthly expenses = $600

Let money earned by her every hour be [tex]x[/tex]

No. of scheduled work hours [tex]=[/tex] [tex]80[/tex]

So,

Total money earned for the month [tex]=[/tex] [tex]80[/tex] × [tex]x[/tex]

[tex]= 80x[/tex]

As we know,

Money left = Total money earned - expenses

[tex]= 80x[/tex] - [tex]$600[/tex] ...(i)

A.T.Q.

Money left must be = $1500

Then, by putting the variables in equation (i), we get

[tex]80x - 600 = 1500[/tex]

Now, solving for  [tex]x[/tex]

[tex]80x - 600 = 1500[/tex]

        [tex]+600 = + 600[/tex]

_______________

[tex]80x = 2100[/tex]

[tex]x = 2100/80[/tex]

∵ [tex]x = 26.25[/tex]

Thus, the required sales are $ [tex]26.25[/tex] per hour or ( [tex]26.25[/tex] × [tex]80[/tex] = $2100) for the month of September.

Learn more about 'savings' here:

brainly.com/question/18051939

Other Questions
Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting A single-slit diffraction pattern is formed on a distant screen. Assuming the angles involved are small, by what factor will the width of the central bright spot on the screen change if the slit width is doubled?a. It will become four times as large.b. It will double.c. It will be cut in half.d. It will become eight times as large.e. It will be cut to one-quarter its original size. Show Work! A warehouse worker shipped 289 boxes of notebooks. Each box contained 36 notebooks. What was the total number of notebooks shipped?(A) 2, 601(B) 9, 404(C) 10, 404(D) 10, 413 Adnde ______ ustedes? Question 18 options: a) voy b) va c) van d) vamos 7. Characteristics of a newsworthy incident include: timeliness, proximity, prominence, uniqueness, human interest, and: A. Visual interest B. Conflict C. Media agenda D. An easily understood situation Write the equation for each question: 9. the sum of 5 and four times a number is 3210. four less than the square of a number is 1211. The product of 3 and four more than a number is 20Marking Brainliest -3(-5x-2u+1) use the distributive property to remove the parentheses A bio catalyst that increases the rate of the reaction without being changeda) Aluminum oxide. b) Silicon dioxide. c) Enzyme. d) Hydrogen peroxide43. What is thethan the reaction substrate.42. A If Ab = 54, find MC. How does coronavirus causes severe pneumonia?