what is the difference between science and engineering?

Answers

Answer 1

Answer:

The following table is among some of the discrepancies between some of the different topics.

Explanation:

Science seems to be the application of structured organized facts which could be interpreted scientifically because when engineering would be a branch of science which deals with either the profession of acquiring including using technological, computational, economical and severity of adverse effects to design and manufacture equipment and devices that seem to be beneficial to mankind.Science would be a set of information and established frameworks whereas the use of these models and information to construct structures as well as mechanisms becomes engineering.

Related Questions

A ____ is marked by two sets of double yellow lines, with each set having a broken line on the inside, and a solid line on the outside. white arrows appear in this lane as well.

Answers

Answer:

  center left-turn lane

Explanation:

A center left turn lane will be marked as described. The arrows, if present, generally indicate that left turns are permitted from the lane with these markings.

__

If the double yellow lines are solid, they are considered to be a "barrier" and are not to be crossed.

Answer:

 center left-turn lane

Explanation:

what recent major breakthroughs are attributed to engineers in improving the quality of our everyday lives?

Answers

From the mass production of the automobile to space travel, from the telephone to the Internet, and from bioengineered foods to clean water, engineers have applied their expertise to improve the quality of our lives

Unless otherwise posted, the speed limit for cars in a residential area is
A: 25 miles
per
hour
B: 30 miles per hour.
C: 35 miles per hour.

Answers

Answer:

The answer is A (25 miles per hour).

Answer:

A. 25 miles

Explanation:

It is that low because people need to have enough time to stop a sudden stop light or pedestrian. Often times people hit people because they are wearing dark clothing or someone stepped out into a unprotected intersection.

Explain orthographic
and multi-view
projection​

Answers

Answer:

Orthographic projection is a projection method to present three-dimensional shapes in two-dimensional format in which the projection lines are drawn to be orthogonal to the plane of projection, such that each view of the three-dimensional object is translated to a view of the orthographic projection and orthogonal to the view

A multiview projection is the representation of a three-dimensional projection by two or more two-dimensional views

Explanation:

If you think a hazard is serious, what is the best way to ensure that OSHA will
conduct a site inspection?
Help

Answers

Answer:

The best way to ensure that OSHA will conduct a site inspection is by the submission a signed (by a current employee or employee representative) Formal Written complaints following OSHA guidelines (which can be found in the  Council of Safety and Health (COSH) website) which will enable the commencement of process for an on site inspection

As such it is advisable to go through the following procedure before, filing a complaint

1) Talk to your workers union about the hazard

2) If you do not belong to a union, talk to your co-workers

3) Inform your employer who has responsibility for on the job safety

4) Speak or have a meeting with OSHA so as to receive guidance before filing a complaint

Explanation:

If you think a hazard is serious, the best way to ensure that OSHA will conduct a site inspection is to file a complaint.

Hazard simply means a potential source of harm. It should be noted that hazards can have detrimental effect on the health of an individual.

If you think a hazard is serious, the best way to ensure that OSHA will conduct a site inspection is to file a complaint asking OSHA to inspect the workplace. In a situation whereby OSHA finds a serious hazard, it'll be kept confidential.

Read related link on:

https://brainly.com/question/25604446

6. Driving with parking lights only (in place of headlights) is against the law. A. True B. False

Answers

Answer:

B false it is illegal to only have got fog lights on though and bright headlights because it can distract other drivers going last and if the y are distracted then that will cause a collision

Hope this helps :)

Explanation:

B. False it is illegal

If sail boats A and B are approaching each other with the wind on different sides, why is vessel A considered the give-way vessel (vessel that must take early and substantial action to avoid a collision)?

Answers

Answer:

The reason is because when the wind approaches each sailboat from a different side, the sailboat that the wind approaches from the port side, which is the left side is the give-way vessel.

Whereby the wind approaches the vessel A from the port (left) side then vessel A is considered the give-way vessel

The give-way vessel is the vessel that will have to take expeditious steps to create  access for the other vessels by either changing course, stopping, or moving with reduced speed

Explanation:

What is the value of current if a 50c charge flows in a conductor over a period of 5 seconds

Answers

Current =charge/time = 50/5 =10A

What is pseudocode ?

Answers

Answer:

Pseudocode is an artificial and informal language that helps programmers develop algorithms. Pseudocode is a "text-based" detail (algorithmic) design tool. The rules of Pseudocode are reasonably straightforward. All statements showing "dependency" are to be indented. These include while, do, for, if, switch.

A notation resembling a simplified programming language, used in program design.

4. Partnership programs between schools and the owners
of local automotive service shops that allow students to
earn school credit and a wage by working in commercial
repair shops are called

Answers

Answer:

Automotive Technology Program

Explanation:

Basically hiring students for hands on training to learn the basics of mechanics.

Steam enters an adiabatic turbine at 8 MPa and 500 C with a mass flow rate of 3 kg/s andleaves at 30 kPa.The isentropic efficiency of the turbine is 0.90. Neglecting the kinetic energy change of the steam, determine (a) the tem-perature at the turbine exit and (b) the power output of theturbine

Answers

Answer:

(a) The exit temperature = 69.1°C

(b)  The power output = 8.3 MW

Explanation:

(a) The enthalpy of steam at 8 MPa and 500°C is given (from online sources) as h₁ = 3399 kJ/kg

The exit temperature = The saturation temperature at 30 kPa = T₄ = 69.096 + 273.15 = 342.246 K

The exit temperature = 69.1°C

(b) The mass flow rate = 3 kg/s

The isentropic efficiency = 0.9 = (h₁ - h₂)/(h₁ - h₂[tex]_s[/tex])

s₁ = 6.727 kJ/kgK

h₂[tex]_s[/tex] = 289.229+ 2335.32* (6.8235 - 6.727 )/6.8235 = 322.26 kJ/kg

Therefore, h₂ = h₁ - (h₁ - h₂[tex]_s[/tex])*0.9

h₂ = 3399  - (3399  - 322.26 )*0.9 = 629.934 kJ/kg

The power output = [tex]\dot m[/tex](h₁ - h₂) = 3 *(3399 - 629.934) = 8307.2 kJ/s =

8.3 MW.

what kind of line is used to indicate the supporting beam

Answers

Answer:horizontal

Explanation: because it is supporting it

Built-up roofing, also called BUR, is the most common roofing material used on low-slope roofs. It is composed of alternating layers of reinforcing fabric and bitumen (asphalt) and is finished with a top layer of aggregate, such as stone or gravel.

If your accelerator pedal gets stuck, what is the first thing you should do?

Answers

If your accelerator gets stuck down, do the following: Shift to neutral. Apply the brakes. Keep your eyes on the road and look for a way out.If your accelerator gets stuck down, do the following:

Shift to neutral.

Apply the brakes.

Keep your eyes on the road and look for a way out.

Warn other drivers by blinking and flashing your hazard lights.

Try to drive the car safely off the road.

Turn off the ignition when you no longer need to change direction.

Engineers are looking for a new material to build the body of an airplane. They agree that the material must be lightweight, but also strong and long-lasting. Above all, the material must maximize the safety of the passengers. Several engineers have developed some initial plans. Which stage of technological design is described in this passage

Answers

Answer:

Design a solution

Explanation:

In the design a solution stage, solutions and ideas to solve the problem or design of the product are generated and details of the problem solution or product design are developed

The generated ideas and details are put together to get a workable solution

Stages of technological design, includes

1) Problem identification

2) Design a solution or designing of a product

3) Design Implementation

4) Solution or product evaluation

First Aid is used for all of the stated reason except:
O Protect Life
O Prevent injury
O Promote recovery
O Preserve life

Answers

prevent injury

Explanation:

one is already injured Soo there's no protection there

The knob at the front of the miter saw about belt height is used to adjust the miter angle true or false

Answers

Answer:

True.

Explanation:

There are two basic saw angles, and the little nob on the front controls the one angle, and the one on the rear controls the other.

You should continuously work to enhance your skills and knowledge .

Answers

Answer:

Improve Your Writing

You may need to improve your ability to express yourself in writing.

To some degree, most organisations rely on the accurate transfer of information and that calls for the accurate use of language. When speaking, most people make multiple errors of grammar and vocabulary, and nobody seems to mind. But when you are doing business at work, then the business agreement is usually in the form of a written document; and that document has to be worded properly.

How would you rate your ability to express yourself properly in writing? Are you a good writer or do you lack knowledge of grammar, punctuation, logic and rhetoric?

If you are not as good at writing as you need to be, then study grammar, study punctuation, logic and rhetoric.

Start by buying a copy of a book called 'Rex Barks' by Phyllis Davenport.

This book is the gateway to grammar - and Phyllis is phenomenal.

Explanation:

You are driving a vehicle that has an automatic transmission. When you park on a hill, you
should
A: Set the parking brake first, before you shift the transmission into Park.
B: Shift the transmission into Park, and leave the parking brake off.
C: Set the parking brake, and shift the transmission into Neutral.

Answers

Answer:

The answer is A. Set the parking brake first, before you shift the transmission into Park.

An automatic gearbox is a multi-speed transmission system. The correct option is A.

What is the automatic transmission?

An automatic gearbox is a multi-speed transmission system that is used in internal combustion engine-powered motor vehicles that do not require any driver input to change forward gears. Thus, making the process of shifting gears automated.

The correct way to park an automatic transmission vehicle is to set the parking brake first before you shift the transmission into Park. Therefore, the correct option is A.

Learn more about Automatic Transmission:

https://brainly.com/question/14093047

#SPJ2

The application of technology results in human-made things called

Answers

Answer:

Internet of things

Explanation:

This is a good example where the application of technology results are applied to human made things.

Internet of things (IOT), involves the application of one technology results–the internet, embedded into devices such as refrigerator, television etc so as to send and receive data (digital instructions). Such applications of technology results has revolutionized the way we use "human made things".

__is a mechanical force generated by a solid object moving through a fluid.

Answers

Answer:

Drag

Explanation:

Where would a secret library be at a school???

Answers

The school’s basement?

3. An underground copper pipe is used to transport oil under a factory. It is very important that this pipe does not oxidize, so engineers use impressed current cathodic protection. a. Would zinc be an appropriate metal to use for cathodic protection? Why or why not? (4 points) b. Engineers attach a sacrificial anode to the copper pipe. To use impressed current cathodic protection, they must attach a battery between the cathode and anode. Which material should the positive side of the battery be attached to? Explain how you know. (4 points)

Answers

Answer:

a) Copper corrosion is prevented by an external current source that provides a condition around the copper that halts the rust through current cathodic protection

Due to the location of the pipeline, an material such as graphite, titanium, or niobium can be used which lasts longer that zinc can be used for longevity of the protection

b) The positive side of the output DC terminals are attached to the anodes such as graphite, while the negative terminals are connected to the copper pipe to be protected

Explanation:

Making the protected metal the cathode will make the metal be the source of electrons into the reaction taking place such that the release of the positive metal ions that results in disintegration takes place at the anode and as such the protected metal made the cathode, to which the negative terminal of the battery is attached is protected.

The proper use of personal protective equipment helps prevent worplace injuries

Answers

Correct have a nice day

Which element refers to musically depicting the emotion in the words of a musical piece?
A intellectual movement of humanism
B. word painting
C. balancing the usage of rhythm and tone color
D. combining lyrics and rhythm in a motet

Answers

Answer:

The correct option is;

B. Word painting

Explanation:

Word painting is the musical art of composition of music literally describing by reflection the action of the lyrics of the music. Word painting is also referred to as text painting or tone painting. Word painting is a technique commonly used in Renaissance music such as madrigals and the technique of word painting can also be found in church music such as in Hendel's Messiah

An example of word painting is where ascending set of musical notes will be paired with lyrics about increasing.

Answer: B. Word painting

Explanation:

Atmospheric air at 1 atm has a dry-bulb temperature of 20°C and a wet-bulb temperature of 15°C. Determine the dew point temperature

Answers

Answer:

The dew point temperature is 11.65°C

Explanation:

Dew point temperature formula is given as follows;

From the modified Apjohn equation, we have;

[tex]P_v = P'_v -\dfrac{1.8 \times p (t - t')}{2700}[/tex]

Which gives;

The saturation vapor pressure at 15°C = 1.705 kPa

[tex]P'_v[/tex] = 1.705 kPa

p = 101.325 kPa

[tex]P_v[/tex] = 1.705 - 1.8*101.325*(20 - 15)/2700 = 1.36725 kPa

The dew point temperature is the steam saturation temperature at 1.36725 kPa

= 6.9696 + (17.4953 - 6.9696)*(0.0136725 - 0.01)/(0.02 - 0.01) = 10.84°C by approximation calculation from steam tables and  284.8 K = 11.65°C from Wolfram Alpha.

Transaction are posted into ledger account from a) voucher b) journal book c) bank statement d) none of these

Answers

Answer:

b) journal book

Explanation:

A ledger is an account for recording balance sheet and income statement transaction entries like cash, investments, inventory and so on.

Before a transaction is posted into the ledger account after an accounting cycle, it is first written in the journal book, before it is then posted in the ledger account. The process of posting refers to the transferring of entries from the journal book to the ledger.

Two technicians are discussing solder wire repair. Technician A says that electrical tape can be used to cover the joint. Technician B says that heat shrink tubing can be used to cover the joint. Who is correct?

Answers

Answer:

8282777727e7e87e7e8e88282883

Which of the following was likely the cause of the innovation of the car airbag?
Select one:
a. Power
b. Luck
c. Wealth
d. Basic necessity

Answers

The answer is D basic necessity

Answer:

D.

Explanation:

Due to the rising amounts of fatalities, air bags were enforced in all cars as a key safety feature. Since then, they have saved countless lives.

What is version control?

Answers

Answer:

version control are a category of software tool that help a software team manage changes to source code over time.

4. Two technicians are discussing the evaporative emission monitor. Technician A says that serious monitor faults cause a blinking malfunction indicator lamp
(MIL) or even an engine shutdown. Technician B says that the engine computer will run the EVAP monitor when fuel level is within 15 to 25 percent and the TP
sensor position is between 9 and 10 percent. Who is correct?
O A. Neither Technician A nor B
O B. Both Technicians A and BN
O C. Technician A
OD. Technician B

Answers

Answer:

The correct option is;

Neither Technician A nor B

Explanation:

The evaporative emission monitor or Evaporaive Emission Control System EVAP System monitors enables the Power Control Module of the car to check fuel system leak integrity and the vapor consumption efficiency during engine combustion

It is a requirement of EPA on cars to check the emission of smug forming evaporates from cars

Serious monitor faults can cause the turning on of the check engine lights and the vehicle will not pass OBD II test, but it will not lead to engine shutdown

It runs when the engine is 15 to 85% full and the TP sensor is between 9% and 35%.

Therefore, the correct option is that neither Technician A nor B are correct.

Other Questions
A horizontal spring with spring constant 85 N/m extends outward from a wall just above floor level. A 2.5 kg box sliding across a frictionless floor hits the end of the spring and compresses it 6.5 cm before the spring expands and shoots the box back out. How fast was the box going when it hit the spring Rearrange the equation so x is the independent variable. y+6=5(x-4) The following unadjusted trial balance is prepared at fiscal year-end for Nelson Company. 1.NELSON COMPANY Debit Credit2. Cash $1,000 3. Merchandise Inventory 12,500 4. Store supplies. 5,800 5. Prepaid Insurance. 2,400 6. Store equipment. 42,900 7. Accumulated depreciation - Store equipment $15,2508. Accounts payable 10,0009.J. Nelson, Capital 32,00010.J. Nelson, Withdrawal 2,200 11. Sales. 111,95012. Sales discounts 2,000 13. Sales returns and allowances 2,200 14. Cost of goods sold 38,400 15. Depreciation expense- Store equipmen 0 16. Salaries expense 35,000 17. Insurance expense 0 18. Rent expense 15,000 19. Store supplies expense 0 20. Advertising expense 9,800 21. Totals $169,200 169,200Nelson company uses a perpetual inventory system. It categorizes the following accounts as selling expenses: Required:1. Prepare adjusting journal entries to reflect each of the following:a. Store supplies still available at fiscal year-end amount to $1,750.b. Expired insurance, an administrative expense, for the fiscal year is $1,400.c. Depreciation expense on store equipment, a selling expense is $1,525 for the fiscal year.d. To estimate shrinkage, a physical count of ending merchandise inventory is taken. It shows $10,900 of inventory is still available at fiscal year-end.2. Prepare a multiple-step income statement for fiscal year 2015.3. Comple the statement of retained earnings and the balance sheet.4. Compute the current ratio, acid-test ratio, and gross margin ratio as of January 31, 2015. (Round ratios to two decimals.) What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT A sprinkler system is being installed in a newly renovated building on campus. The average activation time is supposed to be at most 20 seconds. A series of 12 fire alarm/sprinkler system tests results in an average activation time of 21.5 seconds. Do these data indicate that the design specifications have not been met? The hypotheses to be tested are H0: m = 20 versus Ha: m > 20, where m = the true average activation time of the sprinkler system. Assume that activation times for this system are Normally distributed with s = 3 seconds. (a) What is the value of the observed test statistic? (b) What is the value of the P-value? (c) Are the data statistically significant at the 5% significance level? Explain briefly. (d) What does the decision you made mean with respect to the question "Do these data indicate that the design specifications have not been met?" (e) If the true average activation time of the sprinkler system is, in fact, equal to 20 seconds, what type of error would you have made? [09.01]Identify the domain of the equation y=x2 - 6x + 1. (1 point) You are in charge of paying claims submitted by providers. You notice a certain diagnostic provider ("Doe Diagnostics") requested a substantial payment for a large number of members. Many of these claims are for a certain procedure. You review the same type of procedure for other diagnostic providers and realize Doe Diagnostics' claims far exceed any other provider you reviewed. What should you do? Morganton Company makes one product and it provided the following information to help prepare the master budget:The budgeted selling price per unit is $70. Budgeted unit sales for June, July, August, and September are 8,500, 16,000, 18,000, and 19,000 units What is the accounts receivable balance at the end of July? Unable to borrow from other banks, University Bank is forced to turn to the Federal Reserve for needed funds. The interest rate that the Federal Reserve will charge University Bank is called the Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting