why did leaders such as siddhartha guatana abandon hinduism to create buddhism around 500 Bce

Answers

Answer 1

Explanation:

they believed that Hindu rituals would not lead to spiritual enlightenmdent

Answer 2

Answer:

They believed that Hindu beliefs did not lead to enlightenment.


Related Questions

Which meaning of awful most closely matches it’s meaning in the Aeschylus’ poem (Paragraph 8 of Statement on the assassination of Martin Luther King, Jr.)?

Answers

Answer:

C. Adjective - inspired by a feeling of awe or reverence

please help :) One example of people interacting with their environment is a. trade between geographic regions. b. clearing away trees to plant crops. c. mapping the roads of a region. d. reading about regions that have a mild climate.

Answers

I'd say it's B. because it's the only option that I see that physically interacts with the environment.

Hope this helps!

Answer:

b

Explanation:

Which type of tax provides money to the federal government?
A) poll tax
B) Income tax
C) Property tax
D) Sales tax

Answers

Answer:

Income tax

Explanation:

Answer:

Income tax

Explanation:

People pay tax to the government yearly and those government make up the federal revenue

what is the significance of classifying people in Germany as " without citizenship rights "​

Answers

Answer:

Explanation:

Human rights constitute a concept that is similarly predicated on different

realities; or, using Wittgensteinian terms, it is a concept that intervenes in various

forms of life.52 In other words, the concept of “human rights” intervenes in different activities

human beings, which endow it with meaning. Which does not mean that it has to be put to use.

indiscriminate or equivocal in each praxis, but these praxis are linked and the

meanings given to the concept are not exclusive but complementary or, rather,

analogs.53

Indeed, among the main forms of life in which the concept "rights

human ”is the philosophical, the political and the legal-normative. They are human praxis that

They do not exclude each other but, on the contrary, their complementarity is necessary. If it's about promoting

the dignity of the person, the different “ways of life” where they participate should be considered

human rights. Human praxis in favor of these rights requires reflection

philosophical that accounts for human rights and allows their better understanding; of the

political and pedagogical actions that are carried out in the social sphere; and the instruments

legal requirements that make them operational.

It will be the object of the second chapter of this research to deepen on an understanding

complex of human rights, which assumes them as ideological moments in the processes of

liberation of the peoples; that is, that from the philosophy of liberation, rights are thought

humans, in order to reassess its liberating and emancipating dimension. However, by the

moment, and for the purposes of this chapter, we will take the definitions given by three authors.

These will give us the guideline to know what we are looking for in the praxis and discourse of the first

Defenders of Indians in the 15th century

What predictable body of water was both a source of prosperity also caused damaging floods for
the Egyptian civilization?
the Nile River
the Tigris River
The Amazon River
the Euphrates River

Answers

Answer choice: the Nile River

The Nile River

The Egyptians went there because the flooding river provided rich soil every year.

If Cuba had entered into a trade agreement with an Asian country in 1903 without US approval, which of the following agreements or
amendments would that agreement have violated?
O A. the Teller Amendment
OB.
the Gentlemen's Agreement
O C.
the Platt Amendment
OD. the Root-Takahira Agreement

Answers

Answer:

C

Explanation:

In an effort to give Cuba a level of independance following the US giving the island it's independance from Spain, the US underwent a series of agreements to disallow the US from Annexing Cuba. The Platt Amendement was put forth to protect Cuba from foreign intervention into trade.

what are two groups who discovered america by crossing the atlantic before columbus? (not the vikings)

Answers

Answer:

Long before America was discovered by Columbus, a band of Irish monks led by Saint Brenden visited Americas in sixth century. They traveled on ox-boats and returned after seven years. They reported that they have discovered a land full of vegetation, people believe that the land he mentioned was Newfoundland.

Some scholars say that before Vikings America was visited by Chinese travelers and also by visitors from Ice Age Europe and Africa.

Answer: First of all, let’s not ignore the fact that the Native Americans arrived in the Americas about 23,000 years ago. Even if these history questions and answers just focused on the first Europeans to arrive, Christopher Columbus still can’t claim the glory. About 400 years before Columbus sailed the ocean blue, Viking Leif Eriksson landed in Canada. (Don’t try arguing that his trip doesn’t count because it was in Canada and not the United States.) Columbus didn’t set foot on any of the 50 states during any of his four trips either—only Caribbean Islands and Central and South America. Other Spanish explorers were the first to arrive in what’s now the United States.

Which set of events is in the correct chronological order?
Open Door Policy, completion of the Panama Canal, the sinking of the U.S.S.
Maine
the sinking of the U.S.S. Maine, the start of the Spanish American War, Big
Stick Policy
the start of World War I, Big Stick Policy, the sinking of the U.S.S. Maine
Big Stick Policy, completion of the Panama Canal, Open Door Policy

Answers

Answer:

B) the sinking of the U.S.S. Maine, the start of the Spanish American War, Big

Stick Policy

Explanation:

The sinking of USS Maine was February 15, 1898

The start of the Spanish American was April 21, 1898

The Big Stick Policy came in 1901

Based on these documents, what socioeconomic and sociopolitical conditions in late medieval Europe do you think combined to ‘‘infantilize’’ women and severely limit their legal rights?

Answers

According to the reading of the documents, we can see that the lack of education and the limitation to social and economic experiences were the elements that helped women to be "infantilized" in Europe at the end of the Middle Ages.

As we can see in the documents presented, women were not allowed to participate in courts, to sell and buy goods, to own goods, to sign contracts, or even to receive adequate education. These women were seen as totally dependent on their husbands and incapable of doing anything.

This lack of education and lack of experience with the social and economic sectors of society contributed to women not finding out how to act alone and encouraging concepts that devalued them.

This allowed:

Women were devalued.Women were negatively exploited.Politicians use women's inability to limit rights related to them.Women lived with severe limitations for many years.

You can find more information about women's rights at the link below:

https://brainly.com/question/20586389?referrer=searchResults

https://brainly.com/question/461813?referrer=searchResults

Can we say that Christopher Columbus was a bad person based on our modern morals and goals in
life? Why or why not?

Answers

Answered

he committed genocide so yes. that to me says he’s a bad person

Explanation:

Answer:

Christopher Columbus was a bad person.

Explanation:

In actual fact, Columbus did not discover North America. ... He was the first European to sight the Bahamas archipelago and then the island later named Hispaniola, now split into Haiti and the Dominican Republic. On his subsequent voyages he went farther south, to Central and South America.

Select the correct answer.
By 1942, Germany was fighting a war on two fronts. Which nation was part of Germany's western front?
France
Bulgaria
C.
Poland
D.
North Africa
Reset
Next​

Answers

Answer:

France

Explanation:

Answer:

France

Explanation:

Why did King Cyrus allow some Jewish people to return to Israel?

He did not have room for all of them in his kingdom.
He wanted the religion to spread through Europe.
He had a reputation for religious tolerance.
He wanted the Jewish people to rebuild the temple.

Answers

C. He had a reputation for religious tolerance

How were African Americans involved in the Revolutionary War? Who did they support and why?

Answers


Most black soldiers were scattered throughout the Continental Army in integrated infantry regiments, where they were often assigned to support roles as wagoners, cooks, waiters or artisans. African Americans also served as gunners, sailors on privateers and in the Continental Navy during the Revolution.

African-Americans fought for both sides, providing manpower to both the British and the revolutionaries.

why did columbus seize the town referred to in the document above?

Answers

Answer:

Columbus seized the town because it had valuable natural resources, mainly gold.

This was precisely the main goal of Columbus when he started his voyages: to find a route to Asia, and obtain economic resources for the Spanish Crown. He did not know that he would find another continent with a great amount of resources.

what are the advantages of bilateral and multilateral relation? Mention any four advantages?

Answers

History? Right? Or no

WHOEVER ANSWERS GETS BRAINLIEST which of the following statements, which best describes the lives of nomadic hunter-gatherers? Items like tools and shelter were made so that they were easy to carry when the clans moved around. Clans tended to stay away from water sources, as there were natural predators living in rivers, lakes, and streams. Women and children stayed in camps while men hunted, often for months at a time. It was rare that hunter-gatherers were able to successfully hunt animals, and they relied almost solely on plants to eat.

Answers

I think the answer is A, it's the one that makes the most sense

Answer:

the answer is a

Explanation:

Question 11 of 20
Which diagram most accurately explains changes in media over time?
led to
O A.
The decline in
print media
Newspapers and
magazines no
longer being
relevant
led to
OB.
The development
of the web
A change in who
controlled which
stories and opinions
were published
led to
led to
The availability of
satellite and online
radio
O c.
Radio reaching the
largest audience of
any form of mass
media
led to
O D.
The popularity of
television
Increased
opportunity for
everyday people to
share their political
views

Answers

Answer:

it wood be D

Explanation:

In terms of musical meter, what do my beautiful hangai land (mongolian long song), anush garun ("sweet spring," for armenian duduk), and rag des (for north indian sitar) all have in common?

Answers

Answer:

They all have free rhythm.

Explanation:

Any rhythmic motion which lacks a metrical structure is known as the Free Rhythm. Though it is rarely observed in Western music it is found in Western art music of the 20th and the 21st century. The presence of free rhythm can be seen in indigenous religious, art and folk music throughout the world. The free-rhythm is more popular in Asia, Eastern Europe, the Middle East and parts of Africa.

Locke’s Two Treatises of Civil Government brought forth the ideas of social contract and the _[blank]_ of man.

Answers

Answer:

Equality of man.

Explanation:

Locke’s Two Treatises of Civil Government brought the idea that all men on this planet are equal because they were created by God and all the people born from the same father. So if they are all equal so they all have equal rights in the society. If we want peace and prosperity in the society, we have to give all people equal rights. If we did not do so, it cause great damage to our society.

Discuss Machiavelli's beliefs about the state.

Answers

Answer:

Machiavelli's “state” remains a personal patrimony, a possession more in line with the medieval conception of dominium as the foundation of rule.

Explanation:

In order to “maintain his state”, then, he can only rely upon his own fount of personal characteristics to direct the use of power and establish his claim on rulership. hope this helps you :)

Why are the cave paintings of early humans significant?

Answers

Answer:

Is

Explanation:

The cave paintings of early humans significant how they used to live, the food they used to eat, and what all they made. Early paintings also significant hunting of animals.

Hope this helps....

Have a nice day!!!!

It shows how they use to live and their form of communication

What happened to make plantation owners decide to use only slave labor for growing crops?

Answers

Answer:

Agricultural cultivation of crops is a difficult process during few decades ago. Due to its difficulty and lack of machinery to simplify things, they plantation owners thought it wise to  use slaves in their farm. This is because, it is cheaper, cost less in terms of wages and minimal care for when they got sick when slaves are used compared to using their own people.

Explanation:

What did the Fugitive Slave Act of 1850 do?

It gave slave owners the right to recapture their runaway slaves.

It allowed slaves to escape to the free North.

It gave Northerners the right to hide and protect runaway slaves.

It allowed slaves to escape to Canada.

Answers

Answer:

it gave slave owners the right to recapture slaves

Explanation:

The Fugitive Slave act allowed runaway slaves to be recaptured even if they were in a free state

Answer:

a

Explanation:

...

what are the similarities between Gaia and japanese mythology? BRAINLIEST

Answers

Answer:

Gaea (variant spelling Gaia) is a Greek goddess personifying the Earth. Etymologically, Gaea is a compound word of "Ge," meaning "Earth" and "Aia" meaning "grandmother" (In modern English, the root "Ge" still relates to terms such as geography (Ge/graphos = writing about Earth) and geology (Ge/logos = words about the Earth) displaying an ancient connection to the term Gaea). Though not as popular as the Olympian gods of Greek mythology, Gaea was still revered for her role as "Mother Nature."

The divinization of the earth by the ancient Greeks as the goddess Gaea was their way of recognizing the intrinsic value of the earth's bounty, fertility and beauty. Hellenistic worship of Gaea was also a celebration humanity's symbiotic relationship with nature.

The idea that the fertile earth itself is female, nurturing humankind, was not limited to the Greco-Roman world. Fertility goddess figurines found worldwide often suggest reverence for a divine, potent mother deity. Early cultures of the Middle East (such as the Sumerian) likely made an impact on Greek views of Gaea, and veneration of the pre-Indo-European "Great Mother" had existed since Neolithic times.

In the twentieth century, Gaea has taken on new importance in the New Age movement, neopaganism, and ecological spirituality through the development of the Gaia hypothesis. The belief in a nurturing Earth Mother is also a feature of modern "Goddess" worship. Today, Gaea represents a celebration of the feminine side of creation embodied in the fertility of Mother Nature.

Explanation:

hope this helps

Answer:

The Chimera (Greek Mythology) and Nue (Japanese Mythology) The Nue is often called the Japanese Chimera, and with a good reason. Both of these creatures are a combination of different animals. The Chimera is a combination of a goat, a lion and a dragon, while the Nue is a combination of a monkey, a snake, a tiger and a tanuki.

At this respect Greek and Japanese mythology are quite different since Greek gods are immortal while Japanese are as mortal as human beings. So these are basic similarities and differences between Greek and Japanese myths. The role of gods and their influence on society and culture.

Japanese Creation Myth Long ago all the elements were mixed together with one germ of life. This germ began to mix things around and around until the heavier part sank and the lighter part rose. A muddy sea that covered the entire earth was created.

Furthermore, traditionally Greeks had two gods, like Zeus and Guerra that ruled and commanded over other, minor gods while Japanese had three practically equal deities, namely Takagi-no-Kami, Izanagi, and Izanami. Though the latter two may be compared to Greek Zeus and Guerra who also were husband and wife and were practically equal to each other.

Diana  was the Roman goddess of nature, the hunt, and the moon, associated with the Greek goddess Artemis. She was also a goddess of childbirth and oak groves. Her name derives ultimately from a word for daylight or the daytime sky, so she has a history as a sky goddess as well.

Qué significa que la sociedad de la Edad Media era patriarcal?

Answers

Answer:

(La estructura cuasi maniquea que sigue, tiene el fundamento de señalar los aspectos gráficos y por eso más evidentes, que distancia los derechos y deberes del varón y la mujer, a través de distintos paradigmas)

Explanation:

How did the founding and development of Jamestown enough the first permanent English colony?

Answers

Answer:

On December 6, 1606, the journey to Virginia began on three ships: the Susan Constant, the Godspeed, and the Discovery. On May 13 they picked Jamestown, Virginia for their settlement, which was named after their King, James I. The settlement became the first permanent English settlement in North America.

Explanation:

In 1612, John Rolfe, one of many shipwrecked on Bermuda, helped turn the settlement into a profitable venture. He introduced a new strain of tobacco from seeds that he brought and tobacco became the long-awaited cash crop for the Virginia Company, who wanted to make money off their investment in Jamestown. John Rolfe had the colony plant and harvest tobacco, which became a cash crop and was sold to Europe. This is mainly how Jamestown was good enough to become the first permanent english colony.

Please mark brainliest if that helps!

What are the uses of'Tabulating machine'?​

Answers

Answer:

The tabulating machine was an electromechanical machine designed to assist in summarizing information stored on punched cards. Invented by Herman Hollerith, the machine was developed to help process data for the 1890 U.S. Census. Later models were widely used for business applications such as accounting and inventory control. It spawned a class of machines, known as unit record equipment, and the data processing industry

a. What were the two technological inventions during the Industrial Revolution and how did they affect the tourism and hospitality industry?

Answers

Answer:

Steam engine (two inventions/examples)

Explanation:

The steam engine helped tourism because it allowed people to transport from place to place with greater speed, which opened up opportunities for travel. Increased opportunity, or demand, for travel, means increased opportunity/demand for tourism; small towns will be wondering what could attract more people to their area because a higher population means generating a greater profit for the town. One example of the use of a steam engine is Steamboats. This allowed people to travel over water quickly and in great numbers, helping introduce tourists to different sights or interests along the shoreline.  Additionally, there is the invention of railroads and steam-powered trains. Trains could travel wherever tracks could be built, which opened up opportunities for travel and tourism in several mountain towns, such as Georgetown, CO.

What was the result of William Penn's "Holy Experiment" in Pennsylvania? A. Pennsylvania recognized the religious traditions of Indians. B. Pennsylvania exclusively promoted the Society of Friends. C. Pennsylvania promoted the right of women to preach. D. Pennsylvania respected religious diversity.

Answers

Answer:

D They respected religous diverisity

Explanation:

I had this on a test and got it right and i read about it so

Why did the Erie Lake of America become Dead Lake?

Answers

Answer: Tourism and fishing, both recreational and commercial fishing (primarily along the Canadian shore) are important elements of the economy of Lake Erie. During the 1960s, Lake Erie was declared a “dead lake” due to eutrophication and pollution.

Other Questions
Write 41/12 as a decimal. If necessary, use a bar to indicate which digit or group of digits repeats. Write as a decimal. Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG find the slope between (0, 6) and (-3,9) ASAP!!!!!!!asap!!!!!!!!!!!! asap asap asap in our view which one is the most important characteristic of society why HELP PLZ I GIVE YOU BRAINLIEST IF YOU GET CORRECT PLZ I BEG YOUin a 2-digit number, the tens digit is 5 less than the units digit. if you reverse the number, the result is 7 greater than the double the original number. find the original number the water is.......... Assume that a randomly selected subject is given a bone density test. Those test scores are normally distributed with a mean of 0 and a standard deviation of 1. Find the probability that a given score is less than 1.99 and draw a sketch of the region. In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous plant is crossed with a plant that has yellow pods. Complete the sentences about this cross with the correct terms.1. The phenotype of the heterozygous plant is_________.2. The genotype of the heterozygous plant is_________.3. The genotype of the plant with yellow pods is________.4. The genotypes of gametes produced by a heterozigous plant is______.5. The genotypes of gametes produced by a yellow plant is_______.A. Green podsB. 75% AA and 25% AaC. AAD. 100% AE. Yellow podsF. 50%G. 25%H. 100% aI. 50% A and 50% aJ. AaK. 0%L. 75%M. 75% A and 25% a An ideal gas is enclosed in a piston-cylinder apparatus with the piston being freely movable. Given that LaTeX: \DeltaE is positive and LaTeX: \DeltaH is negative following a process, ____ the system absorbs heat and expands during the process. the system absorbs heat and contracts during the process. the system loses heat and expands during the process. the system loses heat and contracts during the process. the system loses heat but neither expands nor contracts during the process. What weakness of Japan's geography did the allies exploit?A. Japan has no access to the sea, so Allies surrounded them easilyB. Japan relies on Imports, so Allles cut off supply linesC. Japan's borders are very large, so Allies were able to sneak in undetectedD. Japan has large oil fields, so Allies were able to take the oil to refuel while fighting A single-slit diffraction pattern is formed on a distant screen. Assuming the angles involved are small, by what factor will the width of the central bright spot on the screen change if the slit width is doubled?a. It will become four times as large.b. It will double.c. It will be cut in half.d. It will become eight times as large.e. It will be cut to one-quarter its original size. Show Work! A warehouse worker shipped 289 boxes of notebooks. Each box contained 36 notebooks. What was the total number of notebooks shipped?(A) 2, 601(B) 9, 404(C) 10, 404(D) 10, 413 Adnde ______ ustedes? Question 18 options: a) voy b) va c) van d) vamos 7. Characteristics of a newsworthy incident include: timeliness, proximity, prominence, uniqueness, human interest, and: A. Visual interest B. Conflict C. Media agenda D. An easily understood situation Write the equation for each question: 9. the sum of 5 and four times a number is 3210. four less than the square of a number is 1211. The product of 3 and four more than a number is 20Marking Brainliest -3(-5x-2u+1) use the distributive property to remove the parentheses A bio catalyst that increases the rate of the reaction without being changeda) Aluminum oxide. b) Silicon dioxide. c) Enzyme. d) Hydrogen peroxide43. What is thethan the reaction substrate.42. A If Ab = 54, find MC. How does coronavirus causes severe pneumonia?